User: Tinu

gravatar for Tinu
New York
Last seen:
1 year, 6 months ago
4 years, 11 months ago

about me

Posts by Tinu

<prev • 31 results • page 1 of 4 • next >
Answer: A: cramtools Java NoClassDefFoundError
... From the email conversation with the Vadim Zalunin 1) Use JAVA 8 2) to download latest cramtools jar: wget '' -O cramtools-3.0.jar 3) to check version: java -jar cramtools-3.0.jar | grep Version 4) to check if the ...
written 19 months ago by Tinu150
cramtools Java NoClassDefFoundError
... Using cramtools 3.0 The same error was posted in **cramtools cram -I TEST.bam -R Human_Decoy_REF/hs37d5.fa -O TEST.bam.cram** Exception in thread "main" java.lang.reflect.InvocationTargetException at sun.reflect.NativeM ...
cram cramtools written 19 months ago by Tinu150
Answer: A: Mutational Calling with SomaticSeq
... I had similar questions and these are the information I received from the developer "SomaticSeq published classifier we put up on gDrive is trained based on Stage 3 of the DREAM Challenge, with the 5-tool classification for SNV (i.e., Mutect, Varscan, JointSNVMix, SomaticSniper, and VarDict) and 3- ...
written 21 months ago by Tinu150
Comment: C: Understanding SomaticSniper output
... Ran SomaticSniper with recommended settings bam-somaticsniper -Q 40 -G -L -f reference.fa tumor.bam normal.bam output.txt Now the total variants reduced to 6238 and 5824 of them have 'SS' as 2 in the tumor column ...
written 22 months ago by Tinu150
Understanding SomaticSniper output
... Hi, I am trying to understand the output VCF from SomaticSniper According to the header information from the VCF, if the sample field 'SS' shpws the variant status relative to non-adjacent Normal. 0=wildtype,1=germline,2=somatic,3=LOH,4=unknown" **Ran SomaticSniper with the following options on e ...
somaticsniper written 22 months ago by Tinu150
Comment: A: Tool or Script to convert MAF file to VCF ?
... Yes, it worked. Thank you... ...
written 3.2 years ago by Tinu150
Tool or Script to convert MAF file to VCF ?
... Hi, Does anybody know of any script/tool which could convert a MAF file to VCF ?   Thanks, Tinu       ...
maf vcf written 3.2 years ago by Tinu150 • updated 2.6 years ago by Biostar ♦♦ 20
Comment: C: Split a multisample bam using RG tag information
... Yes, it is working. Thank you for the quick response ...
written 3.4 years ago by Tinu150
Comment: C: Split a multisample bam using RG tag information
... Here are the first two non header lines from the bam ​ HWI-ST985:72:D0BK3ACXX:6:2208:8968:43903 99 1 9992 15 36S7M2D38M12S = 10040 140 AACCCTAACCCTAACCCTCTATCCTAACCCTAACCCTCTATCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAA @EEGFEDEDFFEDEDFFFFC;>C?9 ...
written 3.4 years ago by Tinu150
5 follow
Split a multisample bam using RG tag information
... Hello All, I have bams with multiple samples. I couldnot figure out a way to split them to individual sample bams. Below is the RG tags of my BAM. According to SM tag, it can be seen that the sample IDs are T9C, T9B, T9A. Can samtools view command do this. Tried with samtools view , but was not su ...
split a bam multisample bam samtools written 3.4 years ago by Tinu150 • updated 3.4 years ago by Ashutosh Pandey11k

Latest awards to Tinu

Popular Question 2.8 years ago, created a question with more than 1,000 views. For R : File Do Not Exists Error. Isilon File Path Not Recognized In R
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Why Does Vcftools Vcf-Annotate Produce An Empty File
Popular Question 2.8 years ago, created a question with more than 1,000 views. For Split a multisample bam using RG tag information
Teacher 2.8 years ago, created an answer with at least 3 up-votes. For A: Why Does Vcftools Vcf-Annotate Produce An Empty File
Appreciated 3.2 years ago, created a post with more than 5 votes. For A: Vcftools --Geno And --Hwe Filter Options -No Output File Created
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Why Does Vcftools Vcf-Annotate Produce An Empty File
Popular Question 3.4 years ago, created a question with more than 1,000 views. For Vcftools --Geno And --Hwe Filter Options -No Output File Created
Popular Question 3.6 years ago, created a question with more than 1,000 views. For Vcftools --Geno And --Hwe Filter Options -No Output File Created
Teacher 3.7 years ago, created an answer with at least 3 up-votes. For A: Vcftools --Geno And --Hwe Filter Options -No Output File Created
Scholar 3.8 years ago, created an answer that has been accepted. For A: GATK-Depth of Coverage - Issue with per gene coverage


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 910 users visited in the last hour