User: Tinu

gravatar for Tinu
Tinu150
Reputation:
150
Status:
Trusted
Location:
Zürich
Last seen:
2 hours ago
Joined:
5 years, 3 months ago
Email:
t*************@gmail.com

about me

Posts by Tinu

<prev • 32 results • page 1 of 4 • next >
1
vote
0
answers
102
views
0
answers
Problems connecting to NCBI using NCBI edirect
... Hello All, I am trying to run my program which uses NCBI edirect, somehow not able to connect to NCBI python taxon_check.py tempid.list get_taxInfo = "esearch -db taxonomy -query txid%s[Organism:exp] | efetch -format docsum | xtract -pattern DocumentSummary -element TaxId Scientific ...
ncbi edirect esearch written 26 days ago by Tinu150
0
votes
1
answer
714
views
1
answers
Answer: A: cramtools Java NoClassDefFoundError
... From the email conversation with the Vadim Zalunin 1) Use JAVA 8 2) to download latest cramtools jar: wget 'https://github.com/enasequence/cramtools/blob/master/cramtools-3.0.jar?raw=true' -O cramtools-3.0.jar 3) to check version: java -jar cramtools-3.0.jar | grep Version 4) to check if the ...
written 23 months ago by Tinu150
0
votes
1
answer
714
views
1
answer
cramtools Java NoClassDefFoundError
... Using cramtools 3.0 The same error was posted in https://github.com/enasequence/cramtools/issues/55 **cramtools cram -I TEST.bam -R Human_Decoy_REF/hs37d5.fa -O TEST.bam.cram** Exception in thread "main" java.lang.reflect.InvocationTargetException at sun.reflect.NativeM ...
cram cramtools written 23 months ago by Tinu150
1
vote
1
answer
743
views
1
answers
Answer: A: Mutational Calling with SomaticSeq
... I had similar questions and these are the information I received from the developer "SomaticSeq published classifier we put up on gDrive is trained based on Stage 3 of the DREAM Challenge, with the 5-tool classification for SNV (i.e., Mutect, Varscan, JointSNVMix, SomaticSniper, and VarDict) and 3- ...
written 2.1 years ago by Tinu150
0
votes
0
answers
952
views
0
answers
Comment: C: Understanding SomaticSniper output
... Ran SomaticSniper with recommended settings bam-somaticsniper -Q 40 -G -L -f reference.fa tumor.bam normal.bam output.txt Now the total variants reduced to 6238 and 5824 of them have 'SS' as 2 in the tumor column ...
written 2.2 years ago by Tinu150
0
votes
0
answers
952
views
0
answers
Understanding SomaticSniper output
... Hi, I am trying to understand the output VCF from SomaticSniper According to the header information from the VCF, if the sample field 'SS' shpws the variant status relative to non-adjacent Normal. 0=wildtype,1=germline,2=somatic,3=LOH,4=unknown" **Ran SomaticSniper with the following options on e ...
somaticsniper written 2.2 years ago by Tinu150
0
votes
1
answer
2.0k
views
1
answers
Comment: A: Tool or Script to convert MAF file to VCF ?
... Yes, it worked. Thank you... ...
written 3.5 years ago by Tinu150
4
votes
1
answer
2.0k
views
1
answer
Tool or Script to convert MAF file to VCF ?
... Hi, Does anybody know of any script/tool which could convert a MAF file to VCF ? https://wiki.nci.nih.gov/display/TCGA/Mutation+Annotation+Format+%28MAF%29+Specification?showChildren=false   Thanks, Tinu       ...
maf vcf written 3.5 years ago by Tinu150 • updated 3.0 years ago by Biostar ♦♦ 20
1
vote
1
answer
4.6k
views
1
answers
Comment: C: Split a multisample bam using RG tag information
... Yes, it is working. Thank you for the quick response ...
written 3.8 years ago by Tinu150
0
votes
1
answer
4.6k
views
1
answers
Comment: C: Split a multisample bam using RG tag information
... Here are the first two non header lines from the bam ​ HWI-ST985:72:D0BK3ACXX:6:2208:8968:43903 99 1 9992 15 36S7M2D38M12S = 10040 140 AACCCTAACCCTAACCCTCTATCCTAACCCTAACCCTCTATCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAA @EEGFEDEDFFEDEDFFFFC;>C?9 ...
written 3.8 years ago by Tinu150

Latest awards to Tinu

Great Question 22 months ago, created a question with more than 5,000 views. For R : File Do Not Exists Error. Isilon File Path Not Recognized In R
Great Question 22 months ago, created a question with more than 5,000 views. For Vcftools --Geno And --Hwe Filter Options -No Output File Created
Popular Question 22 months ago, created a question with more than 1,000 views. For Tool or Script to convert MAF file to VCF ?
Popular Question 3.2 years ago, created a question with more than 1,000 views. For R : File Do Not Exists Error. Isilon File Path Not Recognized In R
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Why Does Vcftools Vcf-Annotate Produce An Empty File
Popular Question 3.2 years ago, created a question with more than 1,000 views. For Split a multisample bam using RG tag information
Teacher 3.2 years ago, created an answer with at least 3 up-votes. For A: Why Does Vcftools Vcf-Annotate Produce An Empty File
Appreciated 3.5 years ago, created a post with more than 5 votes. For A: Vcftools --Geno And --Hwe Filter Options -No Output File Created
Popular Question 3.5 years ago, created a question with more than 1,000 views. For Why Does Vcftools Vcf-Annotate Produce An Empty File
Popular Question 3.8 years ago, created a question with more than 1,000 views. For Vcftools --Geno And --Hwe Filter Options -No Output File Created
Popular Question 3.9 years ago, created a question with more than 1,000 views. For Vcftools --Geno And --Hwe Filter Options -No Output File Created
Teacher 4.1 years ago, created an answer with at least 3 up-votes. For A: Vcftools --Geno And --Hwe Filter Options -No Output File Created
Scholar 4.1 years ago, created an answer that has been accepted. For A: GATK-Depth of Coverage - Issue with per gene coverage

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1915 users visited in the last hour