Moderator: Jeremy Leipzig

gravatar for Jeremy Leipzig
Reputation:
16,810
Status:
Trusted
Location:
Philadelphia, PA
Website:
http://jermdemo.blogsp...
Twitter:
jermdemo
Scholar ID:
Google Scholar Page
Last seen:
11 hours ago
Joined:
7 years, 9 months ago
Email:
l******@gmail.com

I am a bioinformatics software developer known mostly for my posts on big-ass serversdamn microarray papers, and the reproducible research guilt trip, as well as my review of pipeline frameworks. I have worked in virology, crop genomics, and on various pediatric diseases as a programmer, analyst, and architect. I'm currently a PhD student at Drexel.

Posts by Jeremy Leipzig

<prev • 797 results • page 1 of 80 • next >
0
votes
2
answers
152
views
2
answers
Comment: C: edgeR analysis dilemma -- what samples to include
... unless you have a group that received both A and B I'm not sure you're going to gain much from option 2 ...
written 7 days ago by Jeremy Leipzig17k
0
votes
2
answers
139
views
2
answers
Comment: C: Detection of deletion for mitochondrial NGS analysis at position 3107
... so in the instances where a 'T' is assigned is there a gap further downstream? ...
written 9 days ago by Jeremy Leipzig17k
1
vote
1
answer
209
views
1
answers
Comment: C: pathogenicity predictors of cancer mutations
... this just came out today: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-017-1353-5 ...
written 17 days ago by Jeremy Leipzig17k
0
votes
4
answers
194
views
4
answers
Comment: C: In simple words - what is k-mer??
... also read https://www.biostars.org/p/10772/ - one of my favorite biostar questions ...
written 17 days ago by Jeremy Leipzig17k
0
votes
4
answers
149
views
4
answers
Answer: A: VCF with SNP- count number of 100% missing genotypes
... genomic loci which have 100% missing coverage (or all reference calls) would not show up in a VCF anyway ...
written 23 days ago by Jeremy Leipzig17k
0
votes
1
answer
102
views
1
answers
Answer: A: Find all nuclear genes the mRNA of which binds to the CLUH protein for transport
... There are ~1500 nuclear genes related to mitochondria https://mseqdr.org/mb.php?url=genes.php If you can come up with a GO term or some other gene set to describe your binding proteins of interest an overlap would be easy to generate. ...
written 23 days ago by Jeremy Leipzig17k
0
votes
2
answers
139
views
2
answers
Answer: A: Detection of deletion for mitochondrial NGS analysis at position 3107
... I suppose by "detected" you mean some base in the read aligned to 3107, which is a 'N' (due to historical legacy reasons) AGTAATCCAGGTCGGTTTCTATCTACNTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCT Can you show us a pileup where something aligns to it? If this is troubling I suppose you could look ...
written 23 days ago by Jeremy Leipzig17k
0
votes
0
answers
183
views
0
answers
Comment: C: Different pubmed search using R
... KRAS+MEK+inhibitor|BRAF+inhibitors ...
written 5 weeks ago by Jeremy Leipzig17k
0
votes
0
answers
184
views
0
answers
Comment: C: HGVS annotation for intronic indels with annovar
... there might be some debug-level support for tabular output in snpeff but it doesn't make much sense in real life b/c of the one-to-many nature of variants-transcripts-effects ...
written 5 weeks ago by Jeremy Leipzig17k
1
vote
0
answers
184
views
0
answers
Comment: C: HGVS annotation for intronic indels with annovar
... Yes Annovar is not good for HGVS. Try VEP or SnpEff ...
written 6 weeks ago by Jeremy Leipzig17k

Latest awards to Jeremy Leipzig

Great Question 10 weeks ago, created a question with more than 5,000 views. For Are There Websites Which Allow Users To Post Comments On Peer-Reviewed Articles?
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: How Much Does It Cost To Align A Flowcell In The Cloud?
Good Answer 3 months ago, created an answer that was upvoted at least 5 times. For A: Makefile-Driven Workflows And Bioconductor Objects
Popular Question 3 months ago, created a question with more than 1,000 views. For Is There A Samtools/Bcftools Setting To Call Variants No Matter How Infrequent?
Popular Question 4 months ago, created a question with more than 1,000 views. For Is There A Samtools/Bcftools Setting To Call Variants No Matter How Infrequent?
Popular Question 5 months ago, created a question with more than 1,000 views. For Is There A Samtools/Bcftools Setting To Call Variants No Matter How Infrequent?
Prophet 6 months ago, created a post with more than 20 followers. For Are There Websites Which Allow Users To Post Comments On Peer-Reviewed Articles?
Autobiographer 6 months ago, has more than 80 characters in the information field of the user's profile.
Good Question 6 months ago, asked a question that was upvoted at least 5 times. For Are There Websites Which Allow Users To Post Comments On Peer-Reviewed Articles?
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: How Much Does It Cost To Align A Flowcell In The Cloud?
Commentator 7 months ago, created a comment with at least 3 up-votes. For C: Is Biostar Killing The Bioinformatics Core?
Appreciated 7 months ago, created a post with more than 5 votes. For A: Why Has The Cost Of Genome Sequencing Decline So Rapidly?
Popular Question 7 months ago, created a question with more than 1,000 views. For Is There A Samtools/Bcftools Setting To Call Variants No Matter How Infrequent?
Scholar 7 months ago, created an answer that has been accepted. For A: Retrieve mutation position and ID for a mutation in hgvs format
Appreciated 7 months ago, created a post with more than 5 votes. For A: Why Has The Cost Of Genome Sequencing Decline So Rapidly?
Commentator 7 months ago, created a comment with at least 3 up-votes. For C: Is Biostar Killing The Bioinformatics Core?
Great Question 8 months ago, created a question with more than 5,000 views. For Which C++ Libraries Are Best For Dealing With Fastq Files?
Epic Question 8 months ago, created a question with more than 10,000 views. For Where Can I Get The Asperasoft Command Line Client Ascp
Popular Question 9 months ago, created a question with more than 1,000 views. For Is There A Samtools/Bcftools Setting To Call Variants No Matter How Infrequent?
Great Question 9 months ago, created a question with more than 5,000 views. For Are There Websites Which Allow Users To Post Comments On Peer-Reviewed Articles?
Great Question 10 months ago, created a question with more than 5,000 views. For Are There Websites Which Allow Users To Post Comments On Peer-Reviewed Articles?
Good Answer 10 months ago, created an answer that was upvoted at least 5 times. For A: Why Has The Cost Of Genome Sequencing Decline So Rapidly?
Popular Question 10 months ago, created a question with more than 1,000 views. For Is There A Convention For Representing Indels In Diploid Genome Sequences?
Popular Question 11 months ago, created a question with more than 1,000 views. For Is There A Convention For Representing Indels In Diploid Genome Sequences?
Student 12 months ago, asked a question with at least 3 up-votes. For Why Do Genbank And Refseq Have Different Coordinates For Mitochondrial Features?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 541 users visited in the last hour