Admin: Devon Ryan

gravatar for Devon Ryan
Devon Ryan70k
Reputation:
69,620
Status:
Trusted
Location:
Freiburg, Germany
Twitter:
dpryan79
Scholar ID:
Google Scholar Page
Last seen:
6 hours ago
Joined:
4 years, 5 months ago
Email:
d*******@gmail.com

I'm currently a bioinformatician/data manager at the Max Planck Institute for Immunobiology and Epigenetics in Freiburg, Germany.

I was a post-doc at the DZNE in Bonn, Germany, spending much of my time working on epigenetics and NGS.

Posts by Devon Ryan

<prev • 8,154 results • page 1 of 816 • next >
0
votes
1
answer
128
views
1
answers
Answer: A: Grasp the 200bp gene sequence before all coding sequence in a bacteria genome
... bedtools flank bedtools getfasta Those are the basic steps, assuming you don't have splicing (if you do then you'll need to do some filtering). ...
written 9 hours ago by Devon Ryan70k
0
votes
0
answers
152
views
0
answers
Comment: C: No differential gene expression after tuxedo protocol
... Do you really want to use the tuxedo pipeline? It hasn't been anywhere near best practice for a number of years. What species is this? ...
written 9 hours ago by Devon Ryan70k
1
vote
1
answer
225
views
1
answers
Comment: C: Samtools flagstat results
... Suppose you have the sequence `ATATATATATATATATATAAGCGCTAGCTAGTCGATCTAGCTAGCTGATCGGTCGTCAGAC`. You might have reads `ATATATAT` and `GCGCTAGC`. The latter read can only align to one place in that sequence. The former read can align equally well to multiple places. Consequently, some aligners will pro ...
written 10 hours ago by Devon Ryan70k
0
votes
1
answer
225
views
1
answers
Comment: C: Samtools flagstat results
... By definition a singleton cannot be unmapped. If it is, it's not a singleton. ...
written 18 hours ago by Devon Ryan70k
1
vote
1
answer
225
views
1
answers
Answer: A: Samtools flagstat results
... 1. Singletons occur when only one mate in a pair aligns. You can also have situations where one mate aligns multiple times (e.g., to a simple repeat) and the other only once. Then one will have a single entry and the other may have multiple. Also, if you did any filtering then that'd affect this as ...
written 19 hours ago by Devon Ryan70k
0
votes
0
answers
121
views
0
answers
Comment: C: What softwares can detect fusion genes from SNP-array data?
... Yup, that's one of the ones I read through. It seems like a really problematic way to find fusions. I would think that low coverage mate-pairs or low-coverage long reads would be more useful (or just using RNAseq and looking at fusion transcripts or notably DE genes). ...
written 1 day ago by Devon Ryan70k
0
votes
0
answers
94
views
0
answers
Comment: C: DiffBind: Counting reads in overlapping regions
... Out of curiousity, why do you want diffBind to not combine overlapping regions? That would normally be what you want it to do. ...
written 1 day ago by Devon Ryan70k
0
votes
0
answers
121
views
0
answers
Comment: C: What softwares can detect fusion genes from SNP-array data?
... Hmm, the methods all seem to be CNV based, assuming that the fusions are all associated with them. I wonder how valid that is compared to things like gene read through. ...
written 1 day ago by Devon Ryan70k
1
vote
0
answers
121
views
0
answers
Comment: C: What softwares can detect fusion genes from SNP-array data?
... I'd be a bit surprised if that were even possible. ...
written 1 day ago by Devon Ryan70k
3
votes
1
answer
115
views
1
answers
Answer: A: samtools return seek position
... You can't get that with the command line program. If you really need that information, then I presume you're programming anyway, so you'll want to look at htslib, which underlies samtools and provides the functionality that you're looking for. ...
written 1 day ago by Devon Ryan70k

Latest awards to Devon Ryan

Scholar 17 hours ago, created an answer that has been accepted. For A: Difference between chimeric alignments and multiple mapping
Scholar 17 hours ago, created an answer that has been accepted. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Appreciated 17 hours ago, created a post with more than 5 votes. For BWA 0.7.11 is out, supports ALT contigs
Teacher 17 hours ago, created an answer with at least 3 up-votes. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Teacher 9 days ago, created an answer with at least 3 up-votes. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Appreciated 9 days ago, created a post with more than 5 votes. For BWA 0.7.11 is out, supports ALT contigs
Good Answer 9 days ago, created an answer that was upvoted at least 5 times. For A: which one is better EdgeR or DEGSeq?
Scholar 9 days ago, created an answer that has been accepted. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Teacher 11 days ago, created an answer with at least 3 up-votes. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Teacher 11 days ago, created an answer with at least 3 up-votes. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Scholar 11 days ago, created an answer that has been accepted. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Scholar 11 days ago, created an answer that has been accepted. For A: Difference between chimeric alignments and multiple mapping
Teacher 11 days ago, created an answer with at least 3 up-votes. For A: edgeR: Correct pipeline for DE analysis with multiple conditions and batches
Teacher 11 days ago, created an answer with at least 3 up-votes. For A: which one is better EdgeR or DEGSeq?
Appreciated 13 days ago, created a post with more than 5 votes. For BWA 0.7.11 is out, supports ALT contigs
Teacher 14 days ago, created an answer with at least 3 up-votes. For A: Fields In The Vcf File
Teacher 14 days ago, created an answer with at least 3 up-votes. For A: Overrepresented Sequences Question
Scholar 15 days ago, created an answer that has been accepted. For A: Difference between chimeric alignments and multiple mapping
Appreciated 15 days ago, created a post with more than 5 votes. For BWA 0.7.11 is out, supports ALT contigs
Teacher 18 days ago, created an answer with at least 3 up-votes. For A: Fields In The Vcf File
Teacher 19 days ago, created an answer with at least 3 up-votes. For A: Fields In The Vcf File
Commentator 19 days ago, created a comment with at least 3 up-votes. For C: Why Does Biostar Cover Questions On Epigenetics, But Not Intelligent Design?
Teacher 21 days ago, created an answer with at least 3 up-votes. For A: Fields In The Vcf File
Teacher 21 days ago, created an answer with at least 3 up-votes. For A: Difference between chimeric alignments and multiple mapping
Commentator 22 days ago, created a comment with at least 3 up-votes. For C: Why Does Biostar Cover Questions On Epigenetics, But Not Intelligent Design?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1363 users visited in the last hour