User: komal.rathi

gravatar for komal.rathi
komal.rathi3.4k
Reputation:
3,370
Status:
Trusted
Location:
Children's Hospital of Philadelphia, Philadelphia, PA
Website:
https://github.com/kom...
Scholar ID:
Google Scholar Page
Last seen:
11 hours ago
Joined:
6 years ago
Email:
k**********@gmail.com

Posts by komal.rathi

<prev • 410 results • page 1 of 41 • next >
0
votes
2
answers
1.6k
views
2
answers
Comment: C: GATK ASEReadCounter: Downstream analysis for identifying allele specific express
... I ended up doing a chisq test using the output of ASEReadCounter. ...
written 3 months ago by komal.rathi3.4k
0
votes
0
answers
941
views
0
answers
Comment: C: RSEM output interpretation
... I am using the following parameters: rsem-calculate-expression \ --paired-end \ --no-bam-output \ --quiet \ --no-qualities \ -p {threads} \ --forward-prob 0.5 \ --seed-length 25 \ --fragment-length-mean -1.0 \ --bam {bam} {genomedir} {prefix} ...
written 5 months ago by komal.rathi3.4k
0
votes
1
answer
321
views
1
answers
Comment: C: How to determine RNA-seq samples from dbGaP metadata
... I don't get it. My question is what are those samples with `Molecular Data Type != RNA Seq (NGS)`? Are those also RNA-sequencing? If not, then why is the `Assay Type = RNA-Seq`? ...
written 8 months ago by komal.rathi3.4k
0
votes
1
answer
321
views
1
answer
How to determine RNA-seq samples from dbGaP metadata
... Hi everyone, I have dbGaP metadata for a project that has multiple datatypes (WES, WGS, RNA-seq etc) and I am trying to select only samples corresponding to RNA-seq but I am quite confused looking at a few columns in the metadata. Here are the columns: > plyr::count(dat[,c('Assay_Type_s','a ...
metadata dbgap written 8 months ago by komal.rathi3.4k • updated 8 months ago by Santosh Anand4.7k
0
votes
1
answer
677
views
1
answers
Comment: C: Why does GFF prepared using dexseq_prepare_annotation shows different exon numbe
... Thank you very much for the explanation!! ...
written 19 months ago by komal.rathi3.4k
0
votes
1
answer
1.3k
views
1
answers
Comment: C: exon level quantification using htseq count
... Yes - I am giving it a try. I thought I could just use htseq-count - but after reading up on the docs and from Simon himself - it is not possible to get exon level counts using htseq-count. ...
written 19 months ago by komal.rathi3.4k
4
votes
1
answer
677
views
1
answer
Why does GFF prepared using dexseq_prepare_annotation shows different exon number than UCSC genome browser
... Disclaimer: Tried to post this on bioconductor support but it wont allow me. I tried adding an entire paragraph in "English language" but no - still wouldn't allow me. Hi everyone, I am using DEXSeq for exon quantification. I ran dexseq_prepare_annotation to convert gencode v24 GTF to GFF like thi ...
dexseq exons dexseq_prepare_annotation written 19 months ago by komal.rathi3.4k • updated 19 months ago by Devon Ryan89k
0
votes
1
answer
789
views
1
answers
Comment: C: Filter bam files using a bed file: Why is the mate missing?
... Thanks I just thought it would be simpler than this. I was hoping something like a partial match would work.. ...
written 19 months ago by komal.rathi3.4k
1
vote
1
answer
789
views
1
answer
Filter bam files using a bed file: Why is the mate missing?
... Hi everyone, This is a sorted bam (by coordinates): samtools view 7316-161-T_Aligned.out.sorted.bam | grep 'FCC78FRACXX:1:1101:6639:75204' FCC78FRACXX:1:1101:6639:75204# 163 chr2 74156623 255 23M2445N77M = 74159237 8677 CGCCTATCAATCAGATTAAACTCCTGAACAAAGAAAATAAAGTGCTTAAAGGAGGTGTTGAGGTGGGCC ...
samtools rna-seq written 19 months ago by komal.rathi3.4k
0
votes
1
answer
1.3k
views
1
answers
Comment: C: exon level quantification using htseq count
... Oh I just realized I don't have the `exon_id` columns in the gff while I am passing `exon_id` to -i parameter in htseq-count. How do I get the exon_ids in the gff? According to [this][1] thread it is not that straightforward to get exon level counts using htseq-count. [1]: http://seqanswers.com/ ...
written 19 months ago by komal.rathi3.4k

Latest awards to komal.rathi

Popular Question 7 weeks ago, created a question with more than 1,000 views. For DESeq and Limma+Voom Normalization for Rna-Seq Data Using Ercc Spike-In
Good Answer 7 weeks ago, created an answer that was upvoted at least 5 times. For A: Association between bed files - statistical significance
Popular Question 7 weeks ago, created a question with more than 1,000 views. For Identify genes with extracellular matrix domains
Popular Question 7 weeks ago, created a question with more than 1,000 views. For How to find Significant Trans- Interactions in HiC data
Popular Question 7 weeks ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Appreciated 9 weeks ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Great Question 9 weeks ago, created a question with more than 5,000 views. For Download all eQTL data for all the 9 tissues from GTEx Portal
Great Question 10 weeks ago, created a question with more than 5,000 views. For How To Get Mapping Statistics On Bam File
Popular Question 5 months ago, created a question with more than 1,000 views. For Batch query obsolete gene names to get current HGNC symbol
Scholar 5 months ago, created an answer that has been accepted. For A: cufflink and cuffmerge error
Popular Question 5 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Appreciated 6 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Popular Question 7 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Popular Question 7 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Teacher 7 months ago, created an answer with at least 3 up-votes. For C: have difficults using htseq count
Popular Question 8 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Appreciated 12 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Popular Question 12 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Good Answer 12 months ago, created an answer that was upvoted at least 5 times. For A: Association between bed files - statistical significance
Epic Question 12 months ago, created a question with more than 10,000 views. For Bedtools Genomecoveragebed Usage : How To Create A Genome File?
Good Question 12 months ago, asked a question that was upvoted at least 5 times. For TCGA: What are mRNA expression z-scores? Does TCGA have mRNA expression from controls?
Appreciated 12 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Great Question 13 months ago, created a question with more than 5,000 views. For Bedtools Genomecoveragebed Usage : How To Create A Genome File?
Appreciated 13 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Good Answer 14 months ago, created an answer that was upvoted at least 5 times. For A: Downloading ENCODE regulation data in .bed format by cell line

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1186 users visited in the last hour