User: komal.rathi

gravatar for komal.rathi
komal.rathi3.2k
Reputation:
3,200
Status:
Trusted
Location:
Children's Hospital of Philadelphia, Philadelphia, PA
Website:
https://github.com/kom...
Scholar ID:
Google Scholar Page
Last seen:
3 months ago
Joined:
5 years, 3 months ago
Email:
k**********@gmail.com

Posts by komal.rathi

<prev • 406 results • page 1 of 41 • next >
0
votes
1
answer
392
views
1
answers
Comment: C: Why does GFF prepared using dexseq_prepare_annotation shows different exon numbe
... Thank you very much for the explanation!! ...
written 9 months ago by komal.rathi3.2k
0
votes
1
answer
555
views
1
answers
Comment: C: exon level quantification using htseq count
... Yes - I am giving it a try. I thought I could just use htseq-count - but after reading up on the docs and from Simon himself - it is not possible to get exon level counts using htseq-count. ...
written 9 months ago by komal.rathi3.2k
4
votes
1
answer
392
views
1
answer
Why does GFF prepared using dexseq_prepare_annotation shows different exon number than UCSC genome browser
... Disclaimer: Tried to post this on bioconductor support but it wont allow me. I tried adding an entire paragraph in "English language" but no - still wouldn't allow me. Hi everyone, I am using DEXSeq for exon quantification. I ran dexseq_prepare_annotation to convert gencode v24 GTF to GFF like thi ...
dexseq exons dexseq_prepare_annotation written 9 months ago by komal.rathi3.2k • updated 9 months ago by Devon Ryan81k
0
votes
1
answer
454
views
1
answers
Comment: C: Filter bam files using a bed file: Why is the mate missing?
... Thanks I just thought it would be simpler than this. I was hoping something like a partial match would work.. ...
written 9 months ago by komal.rathi3.2k
1
vote
1
answer
454
views
1
answer
Filter bam files using a bed file: Why is the mate missing?
... Hi everyone, This is a sorted bam (by coordinates): samtools view 7316-161-T_Aligned.out.sorted.bam | grep 'FCC78FRACXX:1:1101:6639:75204' FCC78FRACXX:1:1101:6639:75204# 163 chr2 74156623 255 23M2445N77M = 74159237 8677 CGCCTATCAATCAGATTAAACTCCTGAACAAAGAAAATAAAGTGCTTAAAGGAGGTGTTGAGGTGGGCC ...
samtools rna-seq written 9 months ago by komal.rathi3.2k
0
votes
1
answer
555
views
1
answers
Comment: C: exon level quantification using htseq count
... Oh I just realized I don't have the `exon_id` columns in the gff while I am passing `exon_id` to -i parameter in htseq-count. How do I get the exon_ids in the gff? According to [this][1] thread it is not that straightforward to get exon level counts using htseq-count. [1]: http://seqanswers.com/ ...
written 9 months ago by komal.rathi3.2k
0
votes
1
answer
555
views
1
answers
Comment: C: exon level quantification using htseq count
... Hi Devon, thanks for the suggestion. I used python dexseq_prepare_annotation.py gencode.v23.annotation_subset.gtf gencode.v23.annotation_subset.gff and this is how the gff looks: chr1 dexseq_prepare_annotation.py aggregate_gene 229431245 229434098 . - . gene_id "ENSG00000143632.14" ...
written 9 months ago by komal.rathi3.2k
1
vote
1
answer
555
views
1
answer
exon level quantification using htseq count
... Hi everyone, This is my htseq-count command for gene level counts: htseq-count -f bam -r name -s yes -a 10 -t exon -i gene_id -m union sample_Aligned.out.bam gencode.v23.annotation_subset.gtf > sample_Aligned.out.table.txt ENSG00000075624.13 171006 ENSG00000107554.15 379 ENSG00 ...
htseq-count exon quantifications rna-seq written 9 months ago by komal.rathi3.2k • updated 9 months ago by Devon Ryan81k
0
votes
0
answers
435
views
0
answers
RSEM output interpretation
... Hi everyone, I am using RSEM to get FPKM values as a measure of gene quantification. I am having trouble understanding a couple of things in the output files: In **rsem.genes.results**: gene_id transcript_id(s) length effective_length expected_count TPM FPKM id ENSG00000206588.1 ENST00000 ...
rsem written 10 months ago by komal.rathi3.2k
0
votes
2
answers
3.8k
views
2
answers
Comment: C: htseq-count cannot find pysam
... This works. Thanks!! ...
written 11 months ago by komal.rathi3.2k

Latest awards to komal.rathi

Good Question 3 months ago, asked a question that was upvoted at least 5 times. For TCGA: What are mRNA expression z-scores? Does TCGA have mRNA expression from controls?
Appreciated 3 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Great Question 4 months ago, created a question with more than 5,000 views. For Bedtools Genomecoveragebed Usage : How To Create A Genome File?
Appreciated 4 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Good Answer 5 months ago, created an answer that was upvoted at least 5 times. For A: Downloading ENCODE regulation data in .bed format by cell line
Appreciated 5 months ago, created a post with more than 5 votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 7 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 8 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Commentator 9 months ago, created a comment with at least 3 up-votes. For C: Loading plot with R
Teacher 10 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 11 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 12 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 13 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Epic Question 13 months ago, created a question with more than 10,000 views. For How To Get Mapping Statistics On Bam File
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Student 15 months ago, asked a question with at least 3 up-votes. For Bedtools Genomecoveragebed Usage : How To Create A Genome File?
Appreciated 15 months ago, created a post with more than 5 votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Appreciated 16 months ago, created a post with more than 5 votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Popular Question 16 months ago, created a question with more than 1,000 views. For DESeq and Limma+Voom Normalization for Rna-Seq Data Using Ercc Spike-In
Prophet 16 months ago, created a post with more than 20 followers. For TCGA: Does TCGA cancer studies have mRNA expression data for Control/Normal samples?
Popular Question 16 months ago, created a question with more than 1,000 views. For How to find Significant Trans- Interactions in HiC data

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1433 users visited in the last hour