User: komal.rathi

gravatar for komal.rathi
komal.rathi3.3k
Reputation:
3,340
Status:
Trusted
Location:
Children's Hospital of Philadelphia, Philadelphia, PA
Website:
https://github.com/kom...
Scholar ID:
Google Scholar Page
Last seen:
1 day, 2 hours ago
Joined:
5 years, 9 months ago
Email:
k**********@gmail.com

Posts by komal.rathi

<prev • 410 results • page 1 of 41 • next >
0
votes
2
answers
1.4k
views
2
answers
Comment: C: GATK ASEReadCounter: Downstream analysis for identifying allele specific express
... I ended up doing a chisq test using the output of ASEReadCounter. ...
written 6 days ago by komal.rathi3.3k
0
votes
0
answers
738
views
0
answers
Comment: C: RSEM output interpretation
... I am using the following parameters: rsem-calculate-expression \ --paired-end \ --no-bam-output \ --quiet \ --no-qualities \ -p {threads} \ --forward-prob 0.5 \ --seed-length 25 \ --fragment-length-mean -1.0 \ --bam {bam} {genomedir} {prefix} ...
written 12 weeks ago by komal.rathi3.3k
0
votes
1
answer
241
views
1
answers
Comment: C: How to determine RNA-seq samples from dbGaP metadata
... I don't get it. My question is what are those samples with `Molecular Data Type != RNA Seq (NGS)`? Are those also RNA-sequencing? If not, then why is the `Assay Type = RNA-Seq`? ...
written 5 months ago by komal.rathi3.3k
0
votes
1
answer
241
views
1
answer
How to determine RNA-seq samples from dbGaP metadata
... Hi everyone, I have dbGaP metadata for a project that has multiple datatypes (WES, WGS, RNA-seq etc) and I am trying to select only samples corresponding to RNA-seq but I am quite confused looking at a few columns in the metadata. Here are the columns: > plyr::count(dat[,c('Assay_Type_s','a ...
metadata dbgap written 5 months ago by komal.rathi3.3k • updated 5 months ago by Santosh Anand4.4k
0
votes
1
answer
585
views
1
answers
Comment: C: Why does GFF prepared using dexseq_prepare_annotation shows different exon numbe
... Thank you very much for the explanation!! ...
written 16 months ago by komal.rathi3.3k
0
votes
1
answer
1.1k
views
1
answers
Comment: C: exon level quantification using htseq count
... Yes - I am giving it a try. I thought I could just use htseq-count - but after reading up on the docs and from Simon himself - it is not possible to get exon level counts using htseq-count. ...
written 16 months ago by komal.rathi3.3k
4
votes
1
answer
585
views
1
answer
Why does GFF prepared using dexseq_prepare_annotation shows different exon number than UCSC genome browser
... Disclaimer: Tried to post this on bioconductor support but it wont allow me. I tried adding an entire paragraph in "English language" but no - still wouldn't allow me. Hi everyone, I am using DEXSeq for exon quantification. I ran dexseq_prepare_annotation to convert gencode v24 GTF to GFF like thi ...
dexseq exons dexseq_prepare_annotation written 16 months ago by komal.rathi3.3k • updated 16 months ago by Devon Ryan87k
0
votes
1
answer
659
views
1
answers
Comment: C: Filter bam files using a bed file: Why is the mate missing?
... Thanks I just thought it would be simpler than this. I was hoping something like a partial match would work.. ...
written 16 months ago by komal.rathi3.3k
1
vote
1
answer
659
views
1
answer
Filter bam files using a bed file: Why is the mate missing?
... Hi everyone, This is a sorted bam (by coordinates): samtools view 7316-161-T_Aligned.out.sorted.bam | grep 'FCC78FRACXX:1:1101:6639:75204' FCC78FRACXX:1:1101:6639:75204# 163 chr2 74156623 255 23M2445N77M = 74159237 8677 CGCCTATCAATCAGATTAAACTCCTGAACAAAGAAAATAAAGTGCTTAAAGGAGGTGTTGAGGTGGGCC ...
samtools rna-seq written 16 months ago by komal.rathi3.3k
0
votes
1
answer
1.1k
views
1
answers
Comment: C: exon level quantification using htseq count
... Oh I just realized I don't have the `exon_id` columns in the gff while I am passing `exon_id` to -i parameter in htseq-count. How do I get the exon_ids in the gff? According to [this][1] thread it is not that straightforward to get exon level counts using htseq-count. [1]: http://seqanswers.com/ ...
written 16 months ago by komal.rathi3.3k

Latest awards to komal.rathi

Scholar 12 weeks ago, created an answer that has been accepted. For A: cufflink and cuffmerge error
Popular Question 12 weeks ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Popular Question 12 weeks ago, created a question with more than 1,000 views. For Batch query obsolete gene names to get current HGNC symbol
Appreciated 3 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Popular Question 4 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Popular Question 4 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Teacher 4 months ago, created an answer with at least 3 up-votes. For C: have difficults using htseq count
Popular Question 5 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Epic Question 9 months ago, created a question with more than 10,000 views. For Bedtools Genomecoveragebed Usage : How To Create A Genome File?
Appreciated 9 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Good Answer 9 months ago, created an answer that was upvoted at least 5 times. For A: Association between bed files - statistical significance
Popular Question 9 months ago, created a question with more than 1,000 views. For How to sort fastq.gz files efficiently
Good Question 9 months ago, asked a question that was upvoted at least 5 times. For TCGA: What are mRNA expression z-scores? Does TCGA have mRNA expression from controls?
Appreciated 9 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Great Question 10 months ago, created a question with more than 5,000 views. For Bedtools Genomecoveragebed Usage : How To Create A Genome File?
Appreciated 10 months ago, created a post with more than 5 votes. For C: DEXSeq with cufflinks gtf file
Good Answer 11 months ago, created an answer that was upvoted at least 5 times. For A: Downloading ENCODE regulation data in .bed format by cell line
Appreciated 12 months ago, created a post with more than 5 votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Great Question 14 months ago, created a question with more than 5,000 views. For TCGA: What are mRNA expression z-scores? Does TCGA have mRNA expression from controls?
Teacher 14 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Commentator 15 months ago, created a comment with at least 3 up-votes. For C: Loading plot with R
Great Question 16 months ago, created a question with more than 5,000 views. For TCGA: What are mRNA expression z-scores? Does TCGA have mRNA expression from controls?
Teacher 16 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line
Teacher 18 months ago, created an answer with at least 3 up-votes. For A: Downloading ENCODE regulation data in .bed format by cell line

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1860 users visited in the last hour