User: MAPK

gravatar for MAPK
MAPK1.3k
Reputation:
1,310
Status:
Trusted
Location:
United States
Last seen:
6 hours ago
Joined:
5 years, 2 months ago
Email:
a***********@gmail.com

about me

Posts by MAPK

<prev • 484 results • page 1 of 49 • next >
0
votes
1
answer
107
views
1
answers
Comment: C: How can I map certain values for gene locus against genome?
... Thank you so much, I just got it :) ...
written 1 day ago by MAPK1.3k
0
votes
1
answer
107
views
1
answers
Comment: C: How can I map certain values for gene locus against genome?
... Yes, that would do, but I need to get the `chr`, `start` and `end` information for the given loci. How can I extract that from NCBI or using genes and genome fasta files? Or using the package you have suggested, I would need BP variable, so I am not sure how I can obtain that. ...
written 1 day ago by MAPK1.3k
3
votes
1
answer
107
views
1
answer
How can I map certain values for gene locus against genome?
... I have a data like below. I want to make a plot where I want to map each locus to the genome sequence (Chr 1..15 as X axis) and show the counts in Y axis. How can I create that type of plot? Is there any bioconductor package to do this? locus counts SS1G_03009 40 SS1G_02499 10 ...
R written 1 day ago by MAPK1.3k
0
votes
1
answer
81
views
1
answer
Where can I find Intergenic regions (non-rRNA), retrotransposons and Ribosomal RNA sequences?
... I need Intergenic regions (non-rRNA), retrotransposons and Ribosomal RNA sequences from Sclerotinia sclerotiorum. Where/how can I retrieve those sequences? Thanks for your help in advance. ...
assembly next-gen written 1 day ago by MAPK1.3k • updated 9 hours ago by h.mon21k
0
votes
1
answer
94
views
1
answers
Comment: C: Adaptor trimming for RNAseq
... No, they did not provide anymore information, except for that adaptor sequence. The fastq header only has this info: @K00317:102:HKVG3BBXX:4:1101:15889:1349 1:N:0:TGGTGAAG+TGGTGAAG GTAGACTTGATAGTGATACCACGCTCTTGTTCAACGGCACGAGTATCGGGAGCTCTGGCATCACCAGCCTTTGCGGCGGA + AAFFFJJJ7FJFJJFJAJ ...
written 2 days ago by MAPK1.3k
0
votes
1
answer
94
views
1
answers
Comment: C: Adaptor trimming for RNAseq
... Thanks for your answer. So just to be clear, should I just have >adaptor1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC and omit `NNNNNNATCTCGTATGCCGTCTTCTGCTTG`? ...
written 2 days ago by MAPK1.3k
0
votes
1
answer
94
views
1
answers
Comment: C: Adaptor trimming for RNAseq
... Yes, it was provided by the sequencing facility. ...
written 2 days ago by MAPK1.3k
5
votes
1
answer
94
views
1
answer
Adaptor trimming for RNAseq
... I have a few samples of RNA-seq data. I have this adaptor sequience (`AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG (NNNNNN= 6 nt index)`). Can someone please tell me what `NNNNNNN =6` index indicates here? I was using BBMap tools to do the trimming and created the adaptor file l ...
rna-seq written 2 days ago by MAPK1.3k
0
votes
0
answers
2.3k
views
0
answers
Comment: C: desktop bioinformatics platform specs
... [This][1] is what I use when I am not on cluster. Have linux and added 2x ram and 3x4tb drives(costs you like 150$ per piece) in addition to base specs. [1]: https://www.google.com/url?sa=t&source=web&rct=j&url=https://www.amazon.com/SOLIDWORKS-HP-Workstation-Certified-Refurbished/d ...
written 17 days ago by MAPK1.3k
0
votes
1
answer
113
views
1
answer
Tools to predict microRNAs in Ascomycota(Fungus)
... I have sequenced data from a few species of Ascomycota. I have degradome sequencing, smallRNA sequencing and whole transcriptome sequencing data from these species of Ascomycota. I want to predict microRNA in these species, and was wondering if there is any tool or method I can follow to predict miR ...
smallrna rna-seq microrna written 18 days ago by MAPK1.3k • updated 17 days ago by Buffo1.2k

Latest awards to MAPK

Epic Question 18 hours ago, created a question with more than 10,000 views. For R programming: compare columns to column and get the mismatch
Student 18 hours ago, asked a question with at least 3 up-votes. For R programming, concatenate or combine all the column contents
Popular Question 11 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Student 11 days ago, asked a question with at least 3 up-votes. For R programming, concatenate or combine all the column contents
Popular Question 11 days ago, created a question with more than 1,000 views. For R package for clonal expansion
Popular Question 15 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 19 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 25 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 28 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Great Question 5 weeks ago, created a question with more than 5,000 views. For R programming, concatenate or combine all the column contents
Popular Question 6 weeks ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 7 weeks ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 9 weeks ago, created a question with more than 1,000 views. For R package for clonal expansion
Popular Question 9 weeks ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Great Question 9 weeks ago, created a question with more than 5,000 views. For R programming, concatenate or combine all the column contents
Popular Question 11 weeks ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 12 weeks ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Great Question 3 months ago, created a question with more than 5,000 views. For R programming, concatenate or combine all the column contents
Popular Question 3 months ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 3 months ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 3 months ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Scholar 3 months ago, created an answer that has been accepted. For A: R programming: concatenate three character vectors
Good Question 3 months ago, asked a question that was upvoted at least 5 times. For How to extract specific chromosome from vcf file
Appreciated 3 months ago, created a post with more than 5 votes. For R programming: genotype concordance
Popular Question 4 months ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 873 users visited in the last hour