User: MAPK

gravatar for MAPK
MAPK1.2k
Reputation:
1,220
Status:
Trusted
Location:
United States
Last seen:
6 hours ago
Joined:
4 years, 10 months ago
Email:
a***********@gmail.com

about me

Posts by MAPK

<prev • 407 results • page 1 of 41 • next >
0
votes
1
answer
85
views
1
answers
Comment: C: How do you decide the minimum length for the adapter that needs trimming for sma
... Thank you so much. So if `AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC` is my adapter sequence (length=34), are you saying that I can choose k=34/2 =17? Could you please clarify this? ...
written 1 day ago by MAPK1.2k
0
votes
1
answer
85
views
1
answers
Comment: C: How do you decide the minimum length for the adapter that needs trimming for sma
... Sorry. My original question was a bit confusing, I have just edited my question. I want to understand how to accurately choose the minimum length of the adapter to be trimmed. Should I first do the blast search within the genome (as I have mentioned above) and determine the minimum legth for the ad ...
written 1 day ago by MAPK1.2k
1
vote
1
answer
85
views
1
answer
How do you decide the minimum length for the adapter that needs trimming for small RNAseq
... Hi All, I am trying to trim this adapter I have (NEB-SE.fa= `AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC`) using trimmomatic using command below: `java -jar trimmomatic-0.36.jar SE -phred33 seqL_1_GACGAC_L003_R1_001.fastq trimmed_output.fastq ILLUMINACLIP:NEB-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW ...
trimmomatic trimming smallrnaseq adapter written 1 day ago by MAPK1.2k
0
votes
2
answers
153
views
2
answers
Comment: C: Adapter trimming of small RNAseq data
... Thank you so much. Since my data is single end, I only need to trim 3' adaptor and not worry about 5' ? ...
written 1 day ago by MAPK1.2k
0
votes
2
answers
153
views
2
answers
Comment: C: Adapter trimming of small RNAseq data
... I think this thread here https://www.biostars.org/p/245270/ and your answer somewhat answers why trimming 3' adaptor only should be fine. ...
written 2 days ago by MAPK1.2k
0
votes
2
answers
153
views
2
answers
Comment: C: Adapter trimming of small RNAseq data
... Hi Brad, Thanks for replying to my question. So just to be clear: I am trimming 5' or the read1 (`NEB-SE.fa` with AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) using trimmomatic as below: java -jar trimmomatic-0.36.jar SE -phred33 Ago2.fq ILLUMINACLIP:NEB-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW: ...
written 2 days ago by MAPK1.2k
4
votes
2
answers
116
views
2
answers
Rstudio like IDE for perl
... Hi All, I used to write perl codes in padre and xemacs long time back, but then stopped working with perl (preferred R and Python). However, I need to continue working with one perl pipeline and want to go back and refresh my skills on perl. Is there a better IDE (Rstudio like) for perl that I can ...
perl written 2 days ago by MAPK1.2k • updated 2 days ago by doctor.dee00580
0
votes
2
answers
153
views
2
answers
Comment: C: Adapter trimming of small RNAseq data
... Thank you so much for your help.Changing `k=9 mink=6 hdist=0` did work for me. ...
written 2 days ago by MAPK1.2k
0
votes
2
answers
153
views
2
answers
Comment: C: Adapter trimming of small RNAseq data
... Thank you so much for your help. I changed the `k` parameter `k=9` and that removed both adapters. ...
written 2 days ago by MAPK1.2k
10
votes
2
answers
153
views
2
answers
Adapter trimming of small RNAseq data
... Hi All, I have a question regarding adapter trimming process of small RNA-seq data. The library for this dataset was prepared using NEBNext multiplex small RNA sample prep set for illumina (E7300S/L: https://www.neb.com/-/media/catalog/datacards-or-manuals/manuale7300.pdf). So I used `bbduk.sh` from ...
adapter smallrnaseq trimming rna-seq written 3 days ago by MAPK1.2k • updated 2 days ago by Brad Langhorst100

Latest awards to MAPK

Popular Question 2 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 3 days ago, created a question with more than 1,000 views. For VariantAnnotation installation error in R package
Popular Question 21 days ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 4 weeks ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 5 weeks ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Scholar 5 weeks ago, created an answer that has been accepted. For A: R programming: concatenate three character vectors
Popular Question 6 weeks ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 6 weeks ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 7 weeks ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 8 weeks ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Great Question 9 weeks ago, created a question with more than 5,000 views. For R programming, concatenate or combine all the column contents
Popular Question 3 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Teacher 3 months ago, created an answer with at least 3 up-votes. For A: R programming: string split n number of characters and cbind them in n number of
Popular Question 3 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 4 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 4 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Great Question 4 months ago, created a question with more than 5,000 views. For R programming, concatenate or combine all the column contents
Popular Question 4 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 4 months ago, created a question with more than 1,000 views. For How to obtain the length of coding regions for the list of genes?
Popular Question 5 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 6 months ago, created a question with more than 1,000 views. For How to change the SM tags of BAM files
Popular Question 6 months ago, created a question with more than 1,000 views. For How to estimate the power of association test for small sample size
Popular Question 6 months ago, created a question with more than 1,000 views. For Extracting subset of VCF file for list of genes
Popular Question 6 months ago, created a question with more than 1,000 views. For Command to extract SNPs from VCF file using bcftool
Great Question 6 months ago, created a question with more than 5,000 views. For R programming: compare columns to column and get the mismatch

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 644 users visited in the last hour