User: xieshaojun0621

Reputation:
90
Status:
Trusted
Location:
United States
Last seen:
9 hours ago
Joined:
5 years, 1 month ago
Email:
x*************@qq.com

about me

Posts by xieshaojun0621

<prev • 31 results • page 1 of 4 • next >
0
votes
1
answer
93
views
1
answers
Comment: A: Why chromosome coordinates were given for unmapped reads in hisat2?
... I think you are right. Here are the alignment information for both reads: ``` HWI-ST845:121014:C17LHACXX:8:1101:10013:60438 137 19 37413559 60 50M = 37413559 0 GTTGACAACAGTCTTGTCCAAGGGGATATCCACAGAGTACCTTGTGGGCA CB@FFFFFHHHHHJJJJJJJJJJJJGIIJIJJJJJJJFGHIJJJHIIJJD AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 ...
written 13 days ago by xieshaojun062190
2
votes
1
answer
93
views
1
answer
Why chromosome coordinates were given for unmapped reads in hisat2?
... Same question was also posted here: https://github.com/infphilo/hisat2/issues/125 Briefly, when I was trying to extract unmapped reads from hisat2 results using `samtools -f 4`. I got the alignment result like below: ``` HWI-ST845:121014:C17LHACXX:8:1101:10013:60438 69 19 37413559 ...
unmapped alignment rna-seq hisat2 written 13 days ago by xieshaojun062190
2
votes
1
answer
209
views
1
answer
Add labels in the annotation bar of pheatmap
... I have the code below to generate the heatmap with annotation. ![enter image description here][1] library(pheatmap) # Generate some data test = matrix(rnorm(200), 20, 10) test[1:10, seq(1, 10, 2)] = test[1:10, seq(1, 10, 2)] + 3 test[11:20, seq(2, 10, 2)] = test[11:20, seq(2, 10 ...
labels annotation pheatmap heatmap written 10 weeks ago by xieshaojun062190 • updated 10 weeks ago by biostart240
0
votes
0
answers
131
views
0
answers
Differences of taxid and species_taxid in assembly_summary.txt
... In the file I downloaded here (ftp://ftp.ncbi.nlm.nih.gov/genomes/refseq/bacteria/assembly_summary.txt ), there are two columns: taxid and species_taxid **What's the difference between these two columns?** Some of the lines these two columns are different: 391008 40324 Stenotrophomonas maltoph ...
genome assembly refseq ncbi written 12 weeks ago by xieshaojun062190
0
votes
1
answer
266
views
1
answers
Answer: A: KOBAS web server
... Once I also encountered the same problem. They fixed the problem after I sent an email to the author. At that time, they responded me very quickly. Currently Chinese New Year is there. Maybe they won't respond your email in the next couples days. ...
written 8 months ago by xieshaojun062190
0
votes
2
answers
584
views
2
answers
Answer: A: Integrating DMR data
... If you know how to use Linux, you can install BEDTools and use intersectBed to accomplish your task. ...
written 19 months ago by xieshaojun062190
0
votes
1
answer
541
views
1
answer
How to extract all the terms using summary?
... Hi there! I'm using clusterProfiler to do KEGG enrichment analysis. The function "enricher" was used. `res <- enricher(geneList, TERM2GENE=term2gene, TERM2NAME=term2name, pvalueCutoff = 1, pAdjustMethod = "BH", qvalueCutoff = 1)` Then the function "summary" was used to extract the results. `s ...
clusterprofiler written 19 months ago by xieshaojun062190 • updated 19 months ago by Guangchuang Yu2.0k
0
votes
4
answers
1.0k
views
4
answers
Comment: C: How to define a non differentially expressed gene?
... Thanks for your response. But do you have any suggestions of how to achieve my goal? ...
written 19 months ago by xieshaojun062190
1
vote
0
answers
2.7k
views
0
answers
Comment: C: Scaling data using Pheatmap
... Here is the functions in the [code][1] : scale_rows = function(x){ m = apply(x, 1, mean, na.rm = T) s = apply(x, 1, sd, na.rm = T) return((x - m) / s) } As you can see, scale in this package means removing the mean (centering) and dividing by the standard deviation ...
written 19 months ago by xieshaojun062190
0
votes
0
answers
2.7k
views
0
answers
Comment: C: Scaling data using Pheatmap
... Why do you think pheatmap scales the data to mean 0 and standard deviation 3? ...
written 19 months ago by xieshaojun062190

Latest awards to xieshaojun0621

Popular Question 20 days ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 7 weeks ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 3 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 19 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1164 users visited in the last hour