User: xieshaojun0621

gravatar for xieshaojun0621
Reputation:
170
Status:
Trusted
Location:
United States
Last seen:
9 months ago
Joined:
6 years, 11 months ago
Email:
x*************@qq.com

about me

Posts by xieshaojun0621

<prev • 33 results • page 1 of 4 • next >
0
votes
1
answer
1.2k
views
1
answers
Comment: C: How to use NCBI Gnomon?
... Hi @sunny_shen312, did you have any findings to update this topic? Thanks. ...
written 13 months ago by xieshaojun0621170
1
vote
3
answers
2.3k
views
3
answers
Answer: A: What are the best tools for visualizing DNA methylation result?
... You can also try `ViewBS`: https://github.com/xie186/ViewBS ...
written 14 months ago by xieshaojun0621170
0
votes
1
answer
468
views
1
answers
Comment: A: Why chromosome coordinates were given for unmapped reads in hisat2?
... I think you are right. Here are the alignment information for both reads: ``` HWI-ST845:121014:C17LHACXX:8:1101:10013:60438 137 19 37413559 60 50M = 37413559 0 GTTGACAACAGTCTTGTCCAAGGGGATATCCACAGAGTACCTTGTGGGCA CB@FFFFFHHHHHJJJJJJJJJJJJGIIJIJJJJJJJFGHIJJJHIIJJD AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 ...
written 22 months ago by xieshaojun0621170
3
votes
1
answer
468
views
1
answer
Why chromosome coordinates were given for unmapped reads in hisat2?
... Same question was also posted here: https://github.com/infphilo/hisat2/issues/125 Briefly, when I was trying to extract unmapped reads from hisat2 results using `samtools -f 4`. I got the alignment result like below: ``` HWI-ST845:121014:C17LHACXX:8:1101:10013:60438 69 19 37413559 ...
unmapped alignment rna-seq hisat2 written 22 months ago by xieshaojun0621170
6
votes
2
answers
5.0k
views
6 follow
2
answers
Add labels in the annotation bar of pheatmap
... I have the code below to generate the heatmap with annotation. ![enter image description here][1] library(pheatmap) # Generate some data test = matrix(rnorm(200), 20, 10) test[1:10, seq(1, 10, 2)] = test[1:10, seq(1, 10, 2)] + 3 test[11:20, seq(2, 10, 2)] = test[11:20, seq(2, 10 ...
labels annotation pheatmap heatmap written 2.0 years ago by xieshaojun0621170 • updated 22 months ago by SplitInf10
0
votes
0
answers
515
views
0
answers
Differences of taxid and species_taxid in assembly_summary.txt
... In the file I downloaded here (ftp://ftp.ncbi.nlm.nih.gov/genomes/refseq/bacteria/assembly_summary.txt ), there are two columns: taxid and species_taxid **What's the difference between these two columns?** Some of the lines these two columns are different: 391008 40324 Stenotrophomonas maltoph ...
genome assembly refseq ncbi written 2.1 years ago by xieshaojun0621170
0
votes
1
answer
759
views
1
answers
Answer: A: KOBAS web server
... Once I also encountered the same problem. They fixed the problem after I sent an email to the author. At that time, they responded me very quickly. Currently Chinese New Year is there. Maybe they won't respond your email in the next couples days. ...
written 2.5 years ago by xieshaojun0621170
2
votes
3
answers
1.1k
views
3
answers
Answer: A: Integrating DMR data
... If you know how to use Linux, you can install BEDTools and use intersectBed to accomplish your task. ...
written 3.4 years ago by xieshaojun0621170
1
vote
1
answer
920
views
1
answer
How to extract all the terms using summary?
... Hi there! I'm using clusterProfiler to do KEGG enrichment analysis. The function "enricher" was used. `res <- enricher(geneList, TERM2GENE=term2gene, TERM2NAME=term2name, pvalueCutoff = 1, pAdjustMethod = "BH", qvalueCutoff = 1)` Then the function "summary" was used to extract the results. `s ...
clusterprofiler written 3.4 years ago by xieshaojun0621170 • updated 3.4 years ago by Guangchuang Yu2.3k
0
votes
4
answers
1.9k
views
4
answers
Comment: C: How to define a non differentially expressed gene?
... Thanks for your response. But do you have any suggestions of how to achieve my goal? ...
written 3.4 years ago by xieshaojun0621170

Latest awards to xieshaojun0621

Popular Question 15 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 21 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 21 months ago, created a question with more than 1,000 views. For Where to download older version of R packages in Bioconductor?
Popular Question 21 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 22 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 23 months ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 2.1 years ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?
Popular Question 3.4 years ago, created a question with more than 1,000 views. For How to install a specific version of R package in Bioconductor?

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1533 users visited in the last hour