Question: TRF output to .gff file
0
gravatar for Alice
6.5 years ago by
Alice300
USA
Alice300 wrote:

Hello, biostars!

I'm trying to get .gff file from Tandem Repeat Finder output.

Since TRF can't do that, I've found TRAP tool, which can create .gff. But, TRAP creates as many .gff files as the number of contigs (ok, there is 'cat' command).

The main problem is lines of .gff:

.    TRF    satellite    1    72    144    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 2" "copy number = 36.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TA" ; color 9
.    TRF    satellite    452    512    69    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 14" "copy number = 4.7" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TTCTCCATTAATTA" ; color 9
.    TRF    satellite    453    498    74    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 23" "copy number = 2.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TCTCCATTAATAATTCTCCATTA" ; color 9

 

Instead of seq. name there are " . TRF". Therefore it is impossible to sort this .gff file.

Is there any tool for obtaining 'normal' .gff file or any script to produce such a file from TRF output?

 

PS: RepeatMasker makes .gff files, but my aim is creating one .gff file from several tools, thus i'm going to intersect two or three .gff files. 

next-gen • 2.4k views
ADD COMMENTlink modified 3.4 years ago by Biostar ♦♦ 20 • written 6.5 years ago by Alice300
2
gravatar for lexnederbragt
6.5 years ago by
lexnederbragt1.2k
Oslo, Norway
lexnederbragt1.2k wrote:

Here is a quick python script that I use for this purpose. It uses the latest version of TRF, with the -ngs flag to get the compact output. Not very well tested yet, so use at your own risk:

ADD COMMENTlink modified 9 months ago by RamRS30k • written 6.5 years ago by lexnederbragt1.2k

Thank you! Very useful, I'll try it.

ADD REPLYlink written 6.5 years ago by Alice300

Excuse me, I also meet this question, I wonder where is your python code, thank you!

ADD REPLYlink written 2.4 years ago by yinliduo0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1675 users visited in the last hour