TRF output to .gff file
1
0
Entering edit mode
7.7 years ago
Alice ▴ 300

Hello, biostars!

I'm trying to get .gff file from Tandem Repeat Finder output.

Since TRF can't do that, I've found TRAP tool, which can create .gff. But, TRAP creates as many .gff files as the number of contigs (ok, there is 'cat' command).

The main problem is lines of .gff:

.    TRF    satellite    1    72    144    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 2" "copy number = 36.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TA" ; color 9
.    TRF    satellite    452    512    69    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 14" "copy number = 4.7" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TTCTCCATTAATTA" ; color 9
.    TRF    satellite    453    498    74    +    .    note "satellite sequence" "TRF parameters   2 7 7 80 10 50 2000" "repeat unit size = 23" "copy number = 2.0" "predicted by Tandem Repeats Finder 4.07b" ; label "satellite" ; rpt_type "tandem" ; rpt_unit "TCTCCATTAATAATTCTCCATTA" ; color 9

Instead of seq. name there are . TRF. Therefore it is impossible to sort this .gff file.

Is there any tool for obtaining 'normal' .gff file or any script to produce such a file from TRF output?

PS: RepeatMasker makes .gff files, but my aim is creating one .gff file from several tools, thus i'm going to intersect two or three .gff files.

next-gen • 2.9k views
ADD COMMENT
2
Entering edit mode
7.7 years ago
lexnederbragt ★ 1.3k

Here is a quick python script that I use for this purpose. It uses the latest version of TRF, with the -ngs flag to get the compact output. Not very well tested yet, so use at your own risk:

ADD COMMENT
0
Entering edit mode

Thank you! Very useful, I'll try it.

ADD REPLY
0
Entering edit mode

Excuse me, I also meet this question, I wonder where is your python code, thank you!

ADD REPLY

Login before adding your answer.

Traffic: 2040 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6