I was just wondering if anyone has a method for this. I want to create an amino acid sequence like
ILIKETHISSITE # trying to avoid spaces and the vowels O and U -- sorry biOstars!
And then reverse translate it in every redundancy (below is some output from http://www.molbiol.ru/eng/scripts/01_19.html)
R-translated in organism: Escherichia coli i l i k e t h i s s i t e auucugauuaaagaaacccauauuuccuccauuaccgaa cu a c g g g c caguagu c g g a u a a a a a a a
c u g g u
And then translate each redundancy in every frame to find any hidden messages.
The output would have something like
ILOVETHISSITE
==> SECRETMESSAGE (frame -1)
==> FRAMETWO (frame +2)
Has it been done? Or is anyone up for the challenge?
This paper might interest you: http://www.sciencemag.org/content/337/6102/1628
A little off topic but interesting