Blast - problem with xml output
1
0
Entering edit mode
7.9 years ago
rotmus0 • 0

I encountered a weird problem when I used blast(i'm using blastall 2.2.26).

I have a fasta file with 8 sequences and I'm running blast on it to get the xml output, the problem is I get 1-8 iterations as expected but in addition I get one more empty iteration with iter-num 1 after iteration 8(meaning I have two 1 iteration, one is good the other only have iter-num and statistics).

I have tried to examine the behavior but I can't get absolute results, sometimes it happens and sometimes it don't(it usually happens occasionally on small sets of sequences like 8). I looked every where searching for an explanation with no success.

I run the command:

blastall -p blastn -g F -q -9999 -i test.fasta -d /bio/db/blast/miRNA_hair -e 0.01 -m 7 -v 1 -b 1 -o ~pmrotem/checks/split_and_merge_blast/check.xml

Here is input(test.fasta) content:

>1 <unknown description>
AAAAAAAGGATGGAGGAAGATCTACCAAGCAAA
>2 <unknown description>
AAAAAAGACACCCCCCCCACCACC
>3 <unknown description>
AAAAAAGGAAGGAACTGGGACACGGGA
>4 <unknown description>
AAAAACTTGGATCCTGGCCGGGCGC
>5 <unknown description>
AAAAAGATGAGTGGTGAAAATCTGATC
>6 <unknown description>
AAAAAGCTAACACTCACCTGAGTTTTAAAAAACTC
>7 <unknown description>
AAAAAGCTCGTAGTTGGATCTTGGGA
>8 <unknown description>
AAAAAGCTCGTAGTTGGATCTTGGGATCGAGCGGGCGGTC

And here is the output(check.xml) content:

 < ?xml version="1.0" encoding="UTF-8"?>
 < !DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
    <BlastOutput>
  <BlastOutput_program>blastn</BlastOutput_program>
  <BlastOutput_version>blastn 2.2.26 [Sep-21-2011]</BlastOutput_version>
  <BlastOutput_reference>~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs",  Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
  <BlastOutput_db>/bio/db/blast/miRNA_hair</BlastOutput_db>
  <BlastOutput_query-ID>lcl|1_0</BlastOutput_query-ID>
  <BlastOutput_query-def>1 <unknown description></BlastOutput_query-def>
  <BlastOutput_query-len>33</BlastOutput_query-len>
  <BlastOutput_param>
    <Parameters>
      <Parameters_expect>0.01</Parameters_expect>
      <Parameters_sc-match>1</Parameters_sc-match>
      <Parameters_sc-mismatch>-9999</Parameters_sc-mismatch>
      <Parameters_gap-open>0</Parameters_gap-open>
      <Parameters_gap-extend>0</Parameters_gap-extend>
      <Parameters_filter>F</Parameters_filter>
    </Parameters>
  </BlastOutput_param>
  <BlastOutput_iterations>
    <Iteration>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_query-ID>lcl|1_0</Iteration_query-ID>
      <Iteration_query-def>1 <unknown description></Iteration_query-def>
      <Iteration_query-len>33</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>2</Iteration_iter-num>
      <Iteration_query-ID>lcl|2_0</Iteration_query-ID>
      <Iteration_query-def>2 <unknown description></Iteration_query-def>
      <Iteration_query-len>24</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>3</Iteration_iter-num>
      <Iteration_query-ID>lcl|3_0</Iteration_query-ID>
      <Iteration_query-def>3 <unknown description></Iteration_query-def>
      <Iteration_query-len>27</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>4</Iteration_iter-num>
      <Iteration_query-ID>lcl|4_0</Iteration_query-ID>
      <Iteration_query-def>4 <unknown description></Iteration_query-def>
      <Iteration_query-len>25</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>5</Iteration_iter-num>
      <Iteration_query-ID>lcl|5_0</Iteration_query-ID>
      <Iteration_query-def>5 <unknown description></Iteration_query-def>
      <Iteration_query-len>27</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>6</Iteration_iter-num>
      <Iteration_query-ID>lcl|6_0</Iteration_query-ID>
      <Iteration_query-def>6 <unknown description></Iteration_query-def>
      <Iteration_query-len>35</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>7</Iteration_iter-num>
      <Iteration_query-ID>lcl|7_0</Iteration_query-ID>
      <Iteration_query-def>7 <unknown description></Iteration_query-def>
      <Iteration_query-len>26</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>8</Iteration_iter-num>
      <Iteration_query-ID>lcl|8_0</Iteration_query-ID>
      <Iteration_query-def>8 <unknown description></Iteration_query-def>
      <Iteration_query-len>40</Iteration_query-len>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
      <Iteration_message>No hits found</Iteration_message>
    </Iteration>
    <Iteration>
      <Iteration_iter-num>1</Iteration_iter-num>
      <Iteration_stat>
        <Statistics>
          <Statistics_db-num>16772</Statistics_db-num>
          <Statistics_db-len>1687748</Statistics_db-len>
          <Statistics_hsp-len>0</Statistics_hsp-len>
          <Statistics_eff-space>0</Statistics_eff-space>
          <Statistics_kappa>0.75</Statistics_kappa>
          <Statistics_lambda>1.38629</Statistics_lambda>
          <Statistics_entropy>1.38629</Statistics_entropy>
        </Statistics>
      </Iteration_stat>
    </Iteration>
  </BlastOutput_iterations>
</BlastOutput>

btw, I noticed that it happens when I have no hits.

any suggestions anyone?

xml blast • 2.4k views
ADD COMMENT
0
Entering edit mode

There is a rendering bug, the XML header is not printed correctly, have added two spaces there.

ADD REPLY
0
Entering edit mode
7.9 years ago

Have you tried using the new blastn from the blast+ package? The classic blast is not anymore actively developed and is now called legacy blast. I don't really know if it will solve your problem but in my experience I've found some bugs in the legacy blast package that are not there anymore in the blast+ latest.

See the blast+ downloads page. I would heartily recommend upgrading, it is not difficult to transform your old blast command parameters to the new ones and you will get all the benefits of an up-to-date software package actively developed and debugged.

ADD COMMENT

Login before adding your answer.

Traffic: 1194 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6