Question: Blast Report: Expect(2) = number instead of Expect = number, what does it means?
gravatar for dssouzadan
5.7 years ago by
dssouzadan30 wrote:

Hi all, in the sample below is shown two alignments with Expect and Expect(2) report:

Score =  248 bits (129), Expect = 1e-63
  Identities = 213/263 (80%), Gaps = 34/263 (12%)
  Strand = Plus / Plus

  Query: 161 atatcaccacgtcaaaggtgactccaactcca---ccactccattttgttcagataatgc 217
             |||||||||||||||||||||||||||||  |     | |   || ||||||||||||||
  Sbjct: 481 atatcaccacgtcaaaggtgactccaact-tattgatagtgttttatgttcagataatgc 539

  Query: 218 ccgatgatcatgtcatgcagctccaccgattgtgagaacgacagcgacttccgtcccagc 277
             |||||||   ||||||||||||||||||||| || |            ||||||||||||
  Sbjct: 540 ccgatgactttgtcatgcagctccaccgattttg-g------------ttccgtcccagc 586

  Query: 278 c-gtgcc--aggtgctgcctcagattcaggttatgccgctcaattcgctgcgtatatcgc 334
             |  || |  | ||||||||||||||||||||||||||||||||||||||| |||||||||
  Sbjct: 587 caatgacgta-gtgctgcctcagattcaggttatgccgctcaattcgctgggtatatcgc 645

  Query: 335 ttgctgattacgtgcagctttcccttcaggcggga------------ccagccatccgtc 382
             |||||||||||||||||||||||||||||||||||            |||||||||||||
  Sbjct: 646 ttgctgattacgtgcagctttcccttcaggcgggattcatacagcggccagccatccgtc 705

  Query: 383 ctccatatc-accacgtcaaagg 404
              |||||||| |||||||||||||
  Sbjct: 706 atccatatcaaccacgtcaaagg 728

Score = 80.5 bits (197), Expect(2) = 3e-17
Identities = 35/37 (94%), Positives = 36/37 (97%)
Frame = +2


The calculation of the Expect value for the first sequence is good-old E=(Kmn*exp(-Lam*S))/H
For the second, I'm not really sure at all what Expect(2) means.  It doesn't seem to relate to the E=(Kmn*exp(-Lam*S))/H equation at all.

blast • 1.5k views
ADD COMMENTlink modified 5.7 years ago by David W4.7k • written 5.7 years ago by dssouzadan30
gravatar for David W
5.7 years ago by
David W4.7k
New Zealand
David W4.7k wrote:

The expect(n) values are calculated when there are multiple HSPs in different frames, and come from the sum of statistics from n HSPs. There are a few more details here

ADD COMMENTlink written 5.7 years ago by David W4.7k

Thanks for the answer. Now it makes sense!

ADD REPLYlink written 5.7 years ago by dssouzadan30
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1822 users visited in the last hour