C Programing In Bioinformatics
1
1
Entering edit mode
10.1 years ago
Ankita ▴ 70

how to find the number of codons in a sequence by c programing

c programming • 4.7k views
ADD COMMENT
8
Entering edit mode

Dear ankita: The way the question is currently posed, noone will answer it. You need to provide at least (1) a description of your problem, (2) how you tried to solve it yourself already, and (3) where and how you are stuck.

ADD REPLY
4
Entering edit mode
10.1 years ago
Niek De Klein ★ 2.6k

To help you on the way, you can figure the rest out yourself:

#include <stdio.h>
#include <string.h>
int main()
{
    char sequence[] = "TAGAGCGTAGCGACGTACTGATC";
    printf("Amount of codons: %d\n", (int)strlen(sequence)/3);
}
ADD COMMENT

Login before adding your answer.

Traffic: 2262 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6