tophat failed: Warning: junction database is empty!
0
0
Entering edit mode
6.6 years ago
biolab ★ 1.3k

Hi everyone

I embedded tophat command in a perl script.  When running the script, I found a tophat failure error.  I searched similar problem posts, but none of them were resolved (http://seqanswers.com/forums/showthread.php?t=41021

http://seqanswers.com/forums/showthread.php?t=27454

https://www.biostars.org/p/15366/)

Could you please provide me some advices?  I appreciate any of your answers. THANKS

error message:

[2015-03-01 18:02:45] Searching for junctions via segment mapping
Warning: junction database is empty!
[2015-03-01 18:02:45] Reporting output tracks
    [FAILED]
Error running /usr/local/tophat/bin/tophat_reports --min-anchor 8 --splice-mismatches 0 --min-

... ...

FASTQ file:

@read:C:Chr1:m:29063581:29064263:267 length=100
CACTGGTGATCAGATTGAAGTTCTTAGCAACGGAAGCTGGTGAACCATGGTATTCCATTGGAGCTTCTAAATAAGGTGAAGAAGCTGAGCTCAGATTGCT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@read1
AGGAACTTGATTAGCAAAATCTCCAAGGATTATGTGAAGCTaCTCAAGTATGGTGATTCTTTGTACCGCTGCAATTGTTCCCAATGGGAAGGAGTTCGTT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@read2
ACTCTCAGGTACCAAGTCATTGATACCCCCGGGATTTTGGATAGGCCCTTCCATGCGAAGCTCTCTGCAATCATTGACGACTTGCTGCTCTTGGTCGTAC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII


Reference File:

>genome
aagaaaaaggcacacacatttatattcaaaaactaagaacataggtcacacaagaaagattcatacatcacatggcaaaacaaaaaaaaacaaaaaaatataaagcctggagagcagatgccaaatttttaactatataatttggcatttatagcttaagagaaaatacataatgggtgtagataaaacagtgatagtactgtaaaaataaataaaatagtacatTTAGAGAGACTTTACAGCTAGAAAACGAGGCTCTTTAGGCATGAACTTCTGGTTTGCATAAACATCCATGTAATCTCCAAACACAAACTTTGGATACTTCTTCTCACTTCCTTCCTCTTCCGCCACCGCGGCTGGCCCTATCGCCGCCTTGTACGACGGATTGTAGAAGGAAGCTATAGACCTTCTGTTTCCTTCCTCCCTCGCCAACACCCTGTGCCACGCACTCTTGTACctgccaaccacattttggttaaaactttatactcaaaattgtatattttgtactagtgttgtcgtcgtgtcaccactgtttccggatcaagtcgagattagtgttttggttcgtaaaagatgagtgaaaaatacCTTCCGTTGCTAAGAACTTCAATCTGATCACCAGTGTTGATAACAATGGCATTAGGTAGAGGCTGAACATCGATCCACTCGCCGTCTTTCAAGACCTGAAGGCCATCATATTCATCGTCTTGGAAAAGCAAAACGACACCTCCTGCATCAGTATGAGCTCGAAGGCCATTGACTAGCTCAGGATGAGGACAAGGAGGGTAATGGCTGACTTTAGTCCCAAAGAAAGCTGTCTCTTCTCCATCTTCCATTCCTTCATTGAAAGCTTTCTTTATGTAACCTTTAGGCAAACCCAAATTCTCATCCATCACTTCCATCATCTTGCTCGCTAGCTTCCTCACTTCTTCTCTGTATTCTCCCATAGTCTCTctgtttttacgtacaaatagaaaaacacaaaggtgagatttttgaaaatgggtttgaaagattttgactagttttaaaagagaaaatgtttacTTAATGTTGGATGGCCATTCGTTTTGGTTATGGTCCAAGAGAGTGAAGACATCTTCCCAGTCCACGTTTTCTAGCTTCTCGCCAGAGTTCTTTTGAACCAATTCGTTGAGCAACTTCACGGGATTAGAAGTCTTGAATGCTTCTTCTCTCTCTGTTTTGTAGCAATCTGAGCTCAGCTTCTTCACCTTATTTAGAAGCTCCAATGGAATACCATGGTTCACCAGctacatacatacacagataagcacatgaaaacagagagacagagagagtgtgtgttctgttttttgttagttagatccgaacCTGAAAAAATCCCCACTCTTCGCAAGCTCTAGCGATTTCAGACAGTGTCTTCTCTCTTTCTTCACCATTGAGTTTGGAGAAATCGATAACAGGAATCGCCATttcagatccgcaaagagagagagagagacagatgtgtttttggcaagtcaaaaaagactctgtttagtagtaatcttctgatttagttgt

 

tophat mapping • 3.3k views
ADD COMMENT
0
Entering edit mode

Can you post the exact commands ? 

ADD REPLY
0
Entering edit mode

my command is : tophat2 -p 8 --b2-very-sensitive INDEX in.fq > tophat.log

ADD REPLY
0
Entering edit mode

can u run just bowtie2 and see what happens ?

ADD REPLY
1
Entering edit mode

runing bowtie2 (bowtie2 -x INDEX -U in.fq -S out.sam) is OK.  THANKS!

ADD REPLY
0
Entering edit mode

I am not suggesting you to run bowtie2. I just wanted to know if bowtie2 fails. If its RNA-Seq data and you are aligning to reference genome instead of transcriptome, you should use splice aware aligner like tophat2.

Which genome it is ?

ADD REPLY
1
Entering edit mode

Hi Geeky, it is my test data, which contains only one sequence.  I have run true data, and tophat works now.  However, I am still confused of the error in testing.

ADD REPLY

Login before adding your answer.

Traffic: 1053 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6