Mirna Mirdeep2 : Mirnas_Expressed_All_Samples.Csv Or Result.Csv Which One To Consider?
1
2
Entering edit mode
10.9 years ago
Rm 8.2k

I have a basic question: From the mirdeep2 outputs which one we need to consider for expression comparisions across groups (tumor vs. normal): (Or how researchers report?).

in the below example: mmu-let-7c-5p have different precursors...How to tackle this; I appreciate your inputs.

And also how does programs like "Deseq" handle differences in the initial number of reads for samples.

miRNAs_expressed_all_samples.csv

mmu-let-7c-5p   1452    mmu-let-7c-1    1452    1452    1452.00
mmu-let-7c-5p   1452    mmu-let-7c-2    1452    1452    1452.00

or result.csv.

chr16_6774      5.3     85 +/- 20%      -       729     729     0       0       yes     mmu-let-7c-5p   aae-let-7       -       -       ugagguaguagguuguaugguu  cuguacaaccuucuagcuuucc  ugagguaguagguuguaugguuuagaguuacacccugggaguuaacuguacaaccuucuagcuuucc     chr16:77599897..77600004:+
chr15_6481      0.3     12 +/- 12%      -       733     733     0       0       no      mmu-let-7c-5p   aae-let-7       -       -       ugagguaguagguuguaugguu  ccacaacauccagcucuacg    ccacaacauccagcucuacgccaagacugacugacggccuuuggggugagguaguagguuguaugguu    chr15:85536976..85537086:+
mirna differential expression • 5.9k views
ADD COMMENT
2
Entering edit mode
10.8 years ago
Rm 8.2k

I got the answer from the mirdeep2 Authors:

"I would use the counts from the file miRNAs_expressed_all_samles.csv. These counts are based on the annotated mature sequence plus some small flanking sequence while the result.csv uses the estimated mature sequence by miRDeep2.

Regarding the normalization I think taking RPKM is a good idea and something similar is done in the qunatifier output. Since I am not an expert in differential expression analysis I can only recommend to you to use some package that implements these tests for example the R package DeSeq."

ADD COMMENT
0
Entering edit mode

I have answered similar question seqanswers: http://seqanswers.com/forums/showthread.php?t=28976&highlight=miRNA

ADD REPLY

Login before adding your answer.

Traffic: 1910 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6