Question: Output EMBOSS Needle consensus sequence Biopython/Python 2.7
gravatar for dmenning
4.3 years ago by
United States
dmenning0 wrote:

I have a working python script for EMBOSS Needle that takes the input from two files and outputs the expected paired alignment.

    from Bio.Emboss.Applications import NeedleCommandline
    from Bio import AlignIO

    needle_fname = open("0needleout.txt", "a")

    needle_cline = NeedleCommandline(asequence="2for.fasta", bsequence="2rev.fasta", gapopen=10, gapextend=0.5, outfile="0needle.fasta")
    needle_fname.write('\n' + str(needle_cline))

    stdout, stderr = needle_cline()
    print stdout + stderr

    align ="0needle.fasta", "emboss")


However, instead of the current output showing both sequences and where they overlap, I would like to output the complete consensus sequence including the non overlapped ends.

Current output:

UAF                0 -------------------------------------------------------------------------------------------------------------         0

UAF                0 ---------------------------------------------------------------------------------------------------------------       0

UAF                1 ----------------------------GTAGTATAGCAATTACCTTGGTCTTGTAAGCCAAAAAC      38









UAR              551 GTGTGGGGGTTTCTATGTTGAAACTATACCTG---------------    582


Desired output, ideally in .fasta format:

UAC              551 GTGTGGGGGTTTCTATGTTGAAACTATACCTGGCATCTG                              589


Any suggestions?

sequence alignment • 1.3k views
ADD COMMENTlink modified 4.3 years ago • written 4.3 years ago by dmenning0
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 798 users visited in the last hour