Question: Understanding Illumina Adapters
0
gravatar for irritable_phd_syndrom
3.7 years ago by
irritable_phd_syndrom60 wrote:

I am currently working on a project where I need to trim the adapters off of some single end read RNA-Seq data, and I want to know which sequences to cleave. Illumina TruSeq adapters were used. I have tried following Tuft's explanation and make sense of Illumina's video, but I am left with several unresolved questions.

The TruSeq Universal adapter, seems to be what binds to the flow cell and is

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

The TruSeq Adapter Index N is

 GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-NNNNNN-ATCTCGTATGCCGTCTTCTGCTTG

My impression of how the cDNA fragment attached to the adapters is 

(see text diagram here)

 

 

Here are my questions :

  1. Is this image correct in the single stranded case?

  2. Do I have the correct primer binding site (used for the actual sequencing)?

  3. Do I have the correct oligo for paired end reads, i.e. TAGAGCATACGGCAGAAGACGAAC---------?

  4. Do I have the correct primer (and it's site) for the index read?

 

Per Illumina, I guess I need to include this : "Oligonucleotide sequences © 2007-2013 Illumina, Inc. All rights reserved. Derivative works created by Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited."

oligos illumina adapters • 3.6k views
ADD COMMENTlink modified 3.7 years ago by jotan1.2k • written 3.7 years ago by irritable_phd_syndrom60
0
gravatar for jotan
3.7 years ago by
jotan1.2k
Australia
jotan1.2k wrote:

Have you considered just using an available program to do this?

Cutadapt has worked quite well for me.

http://cutadapt.readthedocs.org/en/latest/index.html

They also handle Illumina Tru-Seq adapters

http://cutadapt.readthedocs.org/en/latest/guide.html#illumina-truseq

 

ADD COMMENTlink written 3.7 years ago by jotan1.2k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1561 users visited in the last hour