Check for Msp1 digestion in sequencing data
1
0
Entering edit mode
8.4 years ago
Jautis ▴ 570

Hi,

I have sequencing data data from an experiment and I want to check whether my Msp1 digestion was successful in all lanes and samples (differences in the proportion of reads mapping to the reference suggests that there was some error between lanes).

How can I check this from my sequencing data? Am I able to just take the proportion of reads starting with a Msp1 cut site, or is there something more I should consider?

Example fragments:

  • ATAACACACCCAACTCTAAACCTCAAAACATTCCTAAATATAATAAACATTCATAACTAAACTCCTAAAATAACTATAAAAATATCACCCACAAAATACCA
  • CGGATGATGGTGTGTTGTTTTGTTATAGTTTTAGTGTTTTGAAGGATTGTTATAATGTTGTTGAGGTGA:nATTGGATTGATTTGAATAATGGTTGGGAGATG
  • AACCAACTTCCCAACCAACATTACAAATACAATACTCATTCATTTTATACCTCTAAATCAATATCAACCTAATAATAAACAATAATTTCAACCATATACCA
RRBS digestion bisulfite-sequencing msp1 • 1.6k views
ADD COMMENT
0
Entering edit mode
8.4 years ago
jr1214 • 0

You could count the number of uncleaved cut sites and then the number of cleaved fragments (will start/end with the cut site).

ADD COMMENT

Login before adding your answer.

Traffic: 2608 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6