Question: RNA-seq bed format read by pash3.0
0
gravatar for jesselee516
3.1 years ago by
jesselee51690
United States
jesselee51690 wrote:

Hi all,

I am recently interested in RNA-seq data from GEO, and I need .bam file for this RNA-seq file. But it does have .bam file, they have .bed, .wig and .tag format file instead. I am curious whether this .bed file could be same as .bam file. I need RNA-seq count on each base pair. But the .bed file show as follows:

chr1    17153    17168    TTTCAACAGCCTTGACTGG__1        +
chr1    17369    17387    CCCCATGTCGCCTCTGTAG__1        -
chr1    17409    17430    AGAGGAACATGGGCTCAGGACA__1        -
chr1    17411    17431    GAGAGGAACATGGGCTCAGGA__1        -

What is that mean exactly?

I know they got this .bed file from pash3.0. Can not find any readme file or pash3.0 output explanation such thing. Does anyone help me how can I get RNA-seq count for each base pair. Thanks very much.

And the GEO .bed file description is shown as follows:

alias: M00734-1.hg19.level.1.release4
Analysis Center: EDACC
Analysis File Type: .bed
Analysis File Name: UCSF-UBC.Peripheral_Blood_Mononuclear_Primary_Cells.smRNA-Seq.TC014.bed
DATA_ANALYSIS_LEVEL: 1
EXPERIMENT_TYPE: smRNA-Seq
GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19
SOFTWARE: Pash
SOFTWARE_VERSION: 3.0
MAXIMUM_ALIGNMENT_LENGTH: Read length
MISMATCHES_ALLOWED: 10% of read length
ALIGNMENTS_ALLOWED: 100
TREATMENT_OF_MULTIPLE_ALIGNMENTS: If a read maps to more than 100 positions it is removed from consideration.
TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: None
ALIGNMENT_POSTPROCESSING: None
RELEASE_NUMBER: Human Epigenome Atlas 4
NUMBER_OF_MAPPED_READS: 1,330,677
PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA: 49.06
PERCENT_READS_MAPPING_TO_miRBase_v16_miRNA_PERCENTILE: 13
MAXIMUM_REPLICATE_CORRELATION: NA

 

ADD COMMENTlink written 3.1 years ago by jesselee51690
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1262 users visited in the last hour