Entering edit mode
8.2 years ago
Ati
▴
50
I have a bed file like :
chr7 109259875 109259938 ENSMUST00000033300 800 +
I want to have sequence of this regions using masked repeats like :
>mm10_ct_polyaclusters_6257_ENSMUST00000033300_range=chr7:109259876-109259938_5'pad=0_3'pad=0_strand=+_repeatMasking=N
ctagcagtgagaagcaagatgagaatctgtaatagcaactgctaagggtgacaagcaaatgtg
Would you please guide me?
Is the bed file defining the masked repeat regions of interest and you want to get the sequence defined by that interval with the fastq header in the format shown?
exactly, I want this