Question: AA prediction from CDR3 DNA sequence
0
gravatar for bioinformatics.cancer
3.9 years ago by
United States
bioinformatics.cancer180 wrote:

Hi, I was trying to figure out how CDR3 DNA sequence in TCR sequencing is converted to the corresponding AA sequence. From a data set I have from Adaptive, an example is:

TCTCTCACTGTGACATCTGCCCAGAAGAACGAGATGGCCGTTTTTCTCTGTGCCAGCAGTTCGACTGGGGGTCCTTATGAACAGTAC If I convert this to AA sequence (6 possible reading frames, using Expasy tool), I get: 5'3' Frame 1 S L T V T S A Q K N E Met A V F L C A S S S T G G P Y E Q Y 5'3' Frame 2 L S L Stop H L P R R T R W P F F S V P A V R L G V L Met N S 5'3' Frame 3 S H C D I C P E E R D G R F S L C Q Q F D W G S L Stop T V 3'5' Frame 1 V L F I R T P S R T A G T E K N G H L V L L G R C H S E R 3'5' Frame 2 Y C S Stop G P P V E L L A Q R K T A I S F F W A D V T V R 3'5' Frame 3 T V H K D P Q S N C W H R E K R P S R S S G Q Met S Q Stop E The reported AA sequence is: CASSSTGGPYEQYF which matches the first of the translated AA sequence. All of the reported sequences start with residue C and end with F. I was wondering why the full sequence is not reported: Met A V F L C A S S S T G G P Y E Q Y and why is F added (to each reported AA) at the end. Is there any reference to this process. Thanks, - Pankaj

Thanks,

  • Pankaj
cdr3 sequence immunosequencing • 1.5k views
ADD COMMENTlink modified 5 months ago by Biostar ♦♦ 20 • written 3.9 years ago by bioinformatics.cancer180

Hi Pankaj, could you please try to format your question into a readable text using e.g. code format for the sequences? Thank you.

ADD REPLYlink modified 3.9 years ago • written 3.9 years ago by Michael Dondrup47k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1718 users visited in the last hour