Question: How to merge the reads into single file
0
gravatar for Bioblazer
3.0 years ago by
Bioblazer50
Pune
Bioblazer50 wrote:

Hi all , I am working on RNA -seq Data analysis. I have reads for specific gene in a bam format which I was extracted using samtools command. That bam file contain 37 reads. I want merge these overlap reads and make into single file. Is there any tool available to do this ? Pls let me know ? (It is a pair end seq reads).

rna-seq • 1.1k views
ADD COMMENTlink written 3.0 years ago by Bioblazer50

Why do you want to "merge" the reads? Are those 37 reads not already in a single bam file?

ADD REPLYlink written 3.0 years ago by jotan1.2k

I am sorry if i didn't make my question clear. I have 37 reads which are mapping for specific gene. They are in single bam file. Since it is a bam file it has overlapping reads . So I want to merge these overlap reads and make into single fasta format sequence.

ADD REPLYlink written 3.0 years ago by Bioblazer50

In other words, you'd like to make the "consensus sequence". Search this site or google for "BAM consensus sequence".

ADD REPLYlink written 3.0 years ago by Devon Ryan88k

AGCGAATACACCGATACGCATCACTCACCAGCCATGCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAG Read 1 GATACGCATCACTCACCAGCCAT*GCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAGGTTCCTTTTGCT Read 2

CACCAGCCATGCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAGGTTCCTTTTGCTCGTCTGCCAGCTG read 3 CACCAGCCATGCAGCTCGCGCAGGTGAACTACCACATCATCTCGGGGGATAGGGCTGAGAATTCCCATCACTACAGGTTCCTTTTGCTCGTCTGCCAGCTG read 4

I highlighted overlapping seq staring region

read 3 and 4 are same which means it is duplicate. If I combine read1 and read4 I will get whole seq upto read 4.Like wise I have 37 read seq some of them are duplicates .So is there tool to overlap

ADD REPLYlink written 3.0 years ago by Bioblazer50
1

Read and do what I suggested above.

ADD REPLYlink written 3.0 years ago by Devon Ryan88k

Those things I cant able to understand can u pls explain me more elobrately... how to merge the overlapping reads. I am having read file in BAM and it has 37 reads how to merge the overlapping region and make the sequence as like raw file or fasta file.

ADD REPLYlink modified 2.9 years ago • written 2.9 years ago by Bioblazer50
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1051 users visited in the last hour