Probabilities and statistical significance of a specific kmer frequency

Question

[arronar]

Hello.

I'm wondering if there is any way to determine if the frequency of a specific k-mer (inside a specific length sequence) is significant statistically.

For example, let's say that we have the following sequence:

ATAGATCATAGATAGATGGAGTTACT

the 5-mer ATAGA has a frequency of value 3.

1) How can we determine which is the probability of this 5-mer to be appeared 3 times in that specific sequence ? 2) Is this probability statistically significant ? Could this probability, probable means something ?

I'm not looking for ready R libraries that might be possible to calculate these but for mathematical/statistic models/ideas to approach it.

Thank you

Answer 1

[natasha.sernova]

I've started writing some explanation, but everything has been already done.

See this post:

A: How To Interpret A T-Test Output Produced By R