Question: blastn query coverage filter
0
gravatar for fortwatts
3.1 years ago by
fortwatts20
fortwatts20 wrote:

I have test.fasta consisting of a single header and read:

>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATCGATCGATGTACAGCTACG TACGTCGAGATCAGAGTGA

Using this as the query in the latest version of blast+ and nt on the command line:

$ blastn -query test.fasta -db ncbi-blast-2.4.0+/db/nt -num_threads 9 -perc_identity 75 -qcov_hsp_perc 55 -outfmt "7 qacc sallseqid evalue bitscore pident qcovs qend sstart send saccver"

Returns:


BLASTN 2.4.0+

Query: why_no_blast_hit

Database: ncbi-blast-2.4.0+/db/nt

Fields: query acc., subject ids, evalue, bit score, % identity, % query coverage per subject, q. end, s. start, s. end, subject acc.ver

3 hits found

why_no_blast_hit gi|607346514|gb|KJ488943.1| 9.03e-39 171 88.667 83 195 248 113 KJ488943.1

why_no_blast_hit gi|607346514|gb|KJ488943.1| 1.51e-36 163 88.000 83 164 248 113 KJ488943.1

why_no_blast_hit gi|607346514|gb|KJ488943.1| 1.96e-35 159 87.500 83 228 248 113 KJ488943.1

BLAST processed 1 queries


All three hits to nt have query coverage of 83%. Therefore, bumping up the -qcov_hsp_perc from 55% to 65% should have no effect on the result:

$ blastn -query test.fasta -db ncbi-blast-2.4.0+/db/nt -num_threads 9 -perc_identity 75 -qcov_hsp_perc 65 -outfmt "7 qacc sallseqid evalue bitscore pident qcovs qend sstart send saccver"


BLASTN 2.4.0+

Query: why_no_blast_hit

Database: ncbi-blast-2.4.0+/db/nt

0 hits found

BLAST processed 1 queries


From blastn -help: " -qcov_hsp_perc <real, 0..100=""> Percent query coverage per hsp"

If the query is getting 83% coverage when qcov_hsp_perc is set to 55, why are there no hits when qcov_hsp_perc is increased to 65 with all other settings kept unchanged?

ADD COMMENTlink modified 3.1 years ago • written 3.1 years ago by fortwatts20
2
gravatar for fortwatts
3.1 years ago by
fortwatts20
fortwatts20 wrote:

I think I have figured this one out. While the total query coverage is >80%, if you actually look at the alignments, there's a series of overlapping HSPs, so the qcov_hsp_perc threshold is not being reached. Lesson learned.

ADD COMMENTlink written 3.1 years ago by fortwatts20
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2249 users visited in the last hour