I have test.fasta consisting of a single header and read:
>why_no_blast_hit CTGATATCTACATACGTACTCGAGCATCGATCGATGACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCGAGCATCGATCGATGTACAGCTACGTACGTCTTGAGCATCGATCGATGTACAGCTACG TACGTCGAGATCAGAGTGA
Using this as the query in the latest version of blast+ and nt on the command line:
$ blastn -query test.fasta -db ncbi-blast-2.4.0+/db/nt -num_threads 9 -perc_identity 75 -qcov_hsp_perc 55 -outfmt "7 qacc sallseqid evalue bitscore pident qcovs qend sstart send saccver"
Returns:
BLASTN 2.4.0+
Query: why_no_blast_hit
Database: ncbi-blast-2.4.0+/db/nt
Fields: query acc., subject ids, evalue, bit score, % identity, % query coverage per subject, q. end, s. start, s. end, subject acc.ver
3 hits found
why_no_blast_hit gi|607346514|gb|KJ488943.1| 9.03e-39 171 88.667 83 195 248 113 KJ488943.1
why_no_blast_hit gi|607346514|gb|KJ488943.1| 1.51e-36 163 88.000 83 164 248 113 KJ488943.1
why_no_blast_hit gi|607346514|gb|KJ488943.1| 1.96e-35 159 87.500 83 228 248 113 KJ488943.1
BLAST processed 1 queries
All three hits to nt have query coverage of 83%. Therefore, bumping up the -qcov_hsp_perc from 55% to 65% should have no effect on the result:
$ blastn -query test.fasta -db ncbi-blast-2.4.0+/db/nt -num_threads 9 -perc_identity 75 -qcov_hsp_perc 65 -outfmt "7 qacc sallseqid evalue bitscore pident qcovs qend sstart send saccver"
BLASTN 2.4.0+
Query: why_no_blast_hit
Database: ncbi-blast-2.4.0+/db/nt
0 hits found
BLAST processed 1 queries
From blastn -help: " -qcov_hsp_perc <real, 0..100=""> Percent query coverage per hsp"
If the query is getting 83% coverage when qcov_hsp_perc is set to 55, why are there no hits when qcov_hsp_perc is increased to 65 with all other settings kept unchanged?