Entering edit mode
9.2 years ago
lwang536
•
0
Hi, I am new to this field. I clipped the adaptor sequence (illumina index 4) using the following command line. After clipping, the file is about 80 MB (originally about 8 GB), I visualized the file using fasta_clipping_histogram.pl and it seems correct. My question is that is this file size usual after clipping or did I set any parameter wrong? Thanks.
$ fastx_clipper -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTAT -l 15 -c -n -v -M 10 -i SRRxxx.fasta -o SRRxxx_clipped.fasta
Clipping Adapter: GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTAT
Min. Length: 15
Non-Clipped reads - discarded.
Input: 62420301 reads.
Output: 596770 reads.
discarded 309725 too-short reads.
discarded 8900023 adapter-only reads.
discarded 52613783 non-clipped reads.
No. You will get better results if you use virtually anything other than FASTX-Toolkit. The best practice depends on your data and experiment, but it will never involve FASTX. Can you describe your data and experiment in more detail?