Question: reading blast result locally thanks
0
gravatar for nasromer2191989
3.0 years ago by
nasromer219198920 wrote:

I use fasta file that contain miRNA sequences as query against EST & GSS database in local blastn to search for similarity sequence but the problem I could not manage to change the sequence to miRNA back to check if it pick new sequence that similar to the query sequence. this the result how it look like

ref|NR_030619.1| Homo sapiens microRNA 543 (MIR543), microRNA Length=78

 Score =   145 bits (78),  Expect = 1e-32
 Identities = 78/78 (100%), Gaps = 0/78 (0%)
 Strand=Plus/Plus

Query  1   TACTTAATGAGAAGTTGCCCGTGtttttttCGCTTTATTTGTGACGAAACATTCGCGGTG  60
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct  1   TACTTAATGAGAAGTTGCCCGTGTTTTTTTCGCTTTATTTGTGACGAAACATTCGCGGTG  60

Query  61  CACTTCTTTTTCAGTATC  78
           |||||||||||||||||| 
Sbjct  61  CACTTCTTTTTCAGTATC  78

anyone have an idea

blast sequence • 794 views
ADD COMMENTlink modified 3.0 years ago by genomax73k • written 3.0 years ago by nasromer219198920
1

Not clear what exactly you are asking. Can you clarify?

If you used known miRNA as a "query" then the "hit" should give you the name of the sequence from the EST/GSS database. What command did you use to run the local blast?

ADD REPLYlink modified 3.0 years ago • written 3.0 years ago by genomax73k

If you want to play with the blast results, it can be easier use tabular output (-outfmt 6). Hope this help in whatever you want to achieve (not clear for me in your post).

ADD REPLYlink written 3.0 years ago by Carlo Yague4.7k

The command line that I use

blastn -db database file -query my/file (known miRNA) -out result file name .out I am new user of blast so while I use miRNA sequence as query What it sould be the result? is it miRNA that similar to query miRNA?

however I would like to do prediction of miRNA based on the file that obtained from database if it is possible

ADD REPLYlink modified 3.0 years ago • written 3.0 years ago by nasromer219198920

anyone have an idea

ADD REPLYlink written 3.0 years ago by nasromer219198920
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1919 users visited in the last hour