Question: Ht-seq count for ncRNA.fasta. count=0
0
gravatar for call
2.5 years ago by
call0
call0 wrote:

Hello.

I used a ncRNA.fa to alignment using RNA-seq samples in TOPHAT

*FASTA:

>ENSSSCT00000024762.1 ncrna:novel chromosome:Sscrofa10.2:2:114672074:114672179:1 gene:ENSSSCG00000023111.1 gene_biotype:snRNA transcript_biotype:snRNA gene_symbol:U6 description:U6 spliceosomal RNA [Source:RFAM;Acc:RF00026]
GCGTCACTGTAGTAGCACACAGACTAAAACTGGAATGATACAGAGAAGATTAGCATAGAT
ACTGTGCCAGAATGGTGTATAAATTAAGGAAGCATTCTGTATTTTT*

My bam file its ok. There are sequence mapped. I look in igv the counts.

*HWI-7001432L:169:C7A9GANXX:2:1101:1151:88174    83      ENSSSCT00000019656.3    166     50      76M     =       80      -162    GAAACAGCAGTGATAAAAATTAAGCCATGAACGAAAGTTTGACTAAGTTATATTAATTAGAGTTGGTAAATCTCGT   1GGGGGGGGEGGGGGGGGGGGGGGGGGDGGGGGGGGGGGGGGGGGGGGGGGGGGFF1GGGGGGGGGGGGGGBBB@A  AS:i:0   XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:76 YT:Z:UU NH:i:1*

Im using a GTF from ensembl (that include no-coding genes)

   * x havana  exon    112829213       112829236       .       +       .       exon_id "ENSSSCE00000248122"; exon_number "2"; exon_version "1"; gene_biotype "lincRNA"; gene_id "ENSSSCG00000030972"; gene_name "CH242-64G23.3"; gene_source "havana"; gene_version "1"; havana_transcript "OTTSUST00000012069"; havana_transcript_version "1"; transcript_biotype "lincRNA"; transcript_id "ENSSSCT00000033495"; transcript_name "CH242-64G23.3-001"; transcript_source "havana"; transcript_version "1"; tss_id "TSS25916";*

However, when I tried to calculted the counts by ht-seq... all transcripts appear 0 counts. I tried to change default parametres... but I did not succeed

Can anybody help me?

Thanks a lot!!

rna-seq ncrna count • 777 views
ADD COMMENTlink modified 2.5 years ago by genomax65k • written 2.5 years ago by call0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 718 users visited in the last hour