Question: Missing BWA alignment score (AS) tag in SAM files
0
gravatar for lironyoffe
3.0 years ago by
lironyoffe0
lironyoffe0 wrote:

Hi,

I'm using BWA 0.7.12. sampe to align paired end reads. I would like to get the alignment score, but can't find AS tag in the SAM files. Same thing happens when using samse for single end reads.
Where did the AS tag go? Is there another way to get the alignment score? (I need it for a downstream analysis and can't use the mapping quality).

Thanks!

sequencing bwa next-gen • 1.3k views
ADD COMMENTlink modified 3.0 years ago by Sarthok70 • written 3.0 years ago by lironyoffe0
0
gravatar for Sarthok
3.0 years ago by
Sarthok70
Pennsylvania State University
Sarthok70 wrote:

Please see this and this and the related post.

Using the bwa mem sould generate the AS score. I have just tested it by aligning PE reads with a reference genome and output is like this:

SRR1972739.3 131 AF086833 2587 60 81M20S = 2531 -57 GAATGATGAGAATAGATTTGTTACACTGGATGGTCAACAATTTTATTGGCCAGTAATGAATCACAGGAATAAATTCATGGCCTCTTTTTCAGTGAGCCATG CC@FFFFFHHHHHJJJJJJJJJJJJJJJJJJJJGIJJJJJJJJJJJJJIJJJJHHJIHJJIGIJIIJIJIJJJJJIIJIGHHHHFFFFFCCEEECCEDDC@ NM:i:5 MD:Z:6A18T25G2G10A15 AS:i:56 XS:i:0

ADD COMMENTlink written 3.0 years ago by Sarthok70

Thanks. I understand that for bwa mem the AS tag is printed, but what about sampe ad samse? My reads are ~50bp long and according to bwa manual the recommended algorithm is BWA-backtrack (sampe/samse).

ADD REPLYlink modified 3.0 years ago • written 3.0 years ago by lironyoffe0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1006 users visited in the last hour