Question: How to count tm value by Nearest-neighbor method?
0
gravatar for a20012002
2.7 years ago by
a200120020
a200120020 wrote:

This is a simple formula used to calculate the temperature >>  Tm = 2(A+T) + 4(G+C) ℃ 

I curious about the Nearest-neighbor method .

I get the deltaH and deltaS  but when I put this 2 parameter in the  formula I got a very small numer than the correct answer .

Can someone teach me how to count ?

wiki: https://en.wikipedia.org/wiki/Nucleic_acid_thermodynamics

this is my primer : GCTAGTTCAACGTCAAGTGTG

Enthalpy : -167 cal/mol

Entropy : -455.9 cal/mol-K

I use this fumula  

Tm = delta H / (delta S + 1.99 x ( ln(c/4)) - 273.15 = 87.14 C

Tm = (-167 ) / ( -455.9 + 1.99 x ln(c/4)) - 273.15 = -272.8

87.14(correct)

-272.15(my answer)

where c is  probe concentration.  In this case  0.1

Can someone teach me how to count ? thx!

pcr tm value bioinformatic • 1.6k views
ADD COMMENTlink modified 14 months ago by inhanlee8810 • written 2.7 years ago by a200120020
1
gravatar for inhanlee88
14 months ago by
inhanlee8810
inhanlee8810 wrote:

It's because the enthalpy unit is not cal/mol but kcal/mol. So, instead of 167, the value should be 167000.

ADD COMMENTlink written 14 months ago by inhanlee8810
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1003 users visited in the last hour