How to count tm value by Nearest-neighbor method?
1
0
Entering edit mode
4.9 years ago
a20012002 • 0

This is a simple formula used to calculate the temperature >>  Tm = 2(A+T) + 4(G+C) ℃ 

I curious about the Nearest-neighbor method .

I get the deltaH and deltaS  but when I put this 2 parameter in the  formula I got a very small numer than the correct answer .

Can someone teach me how to count ?

wiki: https://en.wikipedia.org/wiki/Nucleic_acid_thermodynamics

this is my primer : GCTAGTTCAACGTCAAGTGTG

Enthalpy : -167 cal/mol

Entropy : -455.9 cal/mol-K

I use this fumula  

Tm = delta H / (delta S + 1.99 x ( ln(c/4)) - 273.15 = 87.14 C

Tm = (-167 ) / ( -455.9 + 1.99 x ln(c/4)) - 273.15 = -272.8

87.14(correct)

-272.15(my answer)

where c is  probe concentration.  In this case  0.1

Can someone teach me how to count ? thx!

PCR tm value bioinformatic • 2.9k views
ADD COMMENT
1
Entering edit mode
3.3 years ago
inhanlee88 ▴ 10

It's because the enthalpy unit is not cal/mol but kcal/mol. So, instead of 167, the value should be 167000.

ADD COMMENT

Login before adding your answer.

Traffic: 1757 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6