Question: what is multiple base substitution
0
gravatar for solo7773
3.4 years ago by
solo777370
solo777370 wrote:

Hi guys, I am using mutation data in ICGC. There is a mutation type named "multiple base substitution". Please refer to an example at https://dcc.icgc.org/mutations/MU63993950

In a nutshell, this record says

at chr21:g.10848413,

AATCAAAAGGAATGGAATGGAATTTAATTGAATGGAATCTAAAGGAATG

mutates to

ACTCGAAAGGAGTGGAATGGAATCTAAAGGAAAT

The length of the sequence differs before and after mutation. I am wondering why substitution changes the length of sequence. Besides, why the mutated site is a single base, i.e.chr21:g.10848413 ?

So, can anybody help to explain what "multiple base substitution" is? Thanks a lot.

Arvin

genome • 866 views
ADD COMMENTlink modified 3.4 years ago by Devon Ryan94k • written 3.4 years ago by solo777370
1
gravatar for Devon Ryan
3.4 years ago by
Devon Ryan94k
Freiburg, Germany
Devon Ryan94k wrote:

The full mutation name is rather longer than just chr21:g.10848413, it's chr21:g.10848413AATCAAAAGGAATGGAATGGAATTTAATTGAATGGAATCTAAAGGAATG>ACTCGAAAGGAGTGGAATGGAATCTAAAGGAAAT. Whether one wants to refer to this as a "multiple base substitution" or just an indel is mostly a judgement call, but in the later case it's a bit more obvious why the size changes.

ADD COMMENTlink written 3.4 years ago by Devon Ryan94k

Thanks Devon. Then it's confusing why ICGC uses such a name. I searched in google and google scholar but cannot find details about this.

ADD REPLYlink written 3.4 years ago by solo777370

I agree that their naming is a bit odd. What they're trying to convey is that there are stretches similar to the reference with bases occasionally missing or different. I suppose just calling this an indel would lose that distinction.

ADD REPLYlink written 3.4 years ago by Devon Ryan94k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1513 users visited in the last hour