Entering edit mode
8.9 years ago
zz105
▴
20
I'm running fastqc on command line, and one of the files gives me a error:
sun-java version jdk1.7.0_02 loaded
fastqc version 0.10.1 loaded
Started analysis of SRR1559140_1.fastq.gz
Approx 5% complete for SRR1559140_1.fastq.gz
Approx 10% complete for SRR1559140_1.fastq.gz
Approx 15% complete for SRR1559140_1.fastq.gz
Approx 20% complete for SRR1559140_1.fastq.gz
Approx 25% complete for SRR1559140_1.fastq.gz
Approx 30% complete for SRR1559140_1.fastq.gz
Approx 35% complete for SRR1559140_1.fastq.gz
Approx 40% complete for SRR1559140_1.fastq.gz
Approx 45% complete for SRR1559140_1.fastq.gz
Failed to process file SRR1559140_1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'CTCCTCCCAGCTGGGCTGACEGEH?CEFG<CGDFC3D@HE@ACE<E@59140.4559140.4T8TAGCTTAGEBB1:9?@DDDDDF:140.431' didn't start with '+'
at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:142)
at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:105)
at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:76)
at java.lang.Thread.run(Thread.java:722)
Anyone knows how to fix it? To me, this should not be the line that start with '+'
Looks like you may have a corrupt fastq record in that file. Did you use
fastq-dumpto get this file or some other means?You are also using a 4-year old version of FastQC (current is v. 0.11.5). You may want to upgrade.
yes we used fastq-dump. I do think the record is corrupted,but not sure how to fix it. Or just discard it? about the version of FastQC, it is just out of my control.
Best way would be to delete that record (4 lines) unless you want to try your luck with
fastq-dumpagain to see if you can get a good copy. If this is paired end data be sure to delete the corresponding record in other file as well.