RNA-seq fastqc error

Question

[zz105]

I'm running fastqc on command line, and one of the files gives me a error:

sun-java version jdk1.7.0_02 loaded
fastqc version 0.10.1 loaded
Started analysis of SRR1559140_1.fastq.gz
Approx 5% complete for SRR1559140_1.fastq.gz
Approx 10% complete for SRR1559140_1.fastq.gz
Approx 15% complete for SRR1559140_1.fastq.gz
Approx 20% complete for SRR1559140_1.fastq.gz
Approx 25% complete for SRR1559140_1.fastq.gz
Approx 30% complete for SRR1559140_1.fastq.gz
Approx 35% complete for SRR1559140_1.fastq.gz
Approx 40% complete for SRR1559140_1.fastq.gz
Approx 45% complete for SRR1559140_1.fastq.gz
Failed to process file SRR1559140_1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'CTCCTCCCAGCTGGGCTGACEGEH?CEFG<CGDFC3D@HE@ACE<E@59140.4559140.4T8TAGCTTAGEBB1:9?@DDDDDF:140.431' didn't start with '+'
    at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:142)
    at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:105)
    at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:76)
    at java.lang.Thread.run(Thread.java:722)

Anyone knows how to fix it? To me, this should not be the line that start with '+'

[GenoMax]

Looks like you may have a corrupt fastq record in that file. Did you use fastq-dump to get this file or some other means?

You are also using a 4-year old version of FastQC (current is v. 0.11.5). You may want to upgrade.

[zz105]

yes we used fastq-dump. I do think the record is corrupted,but not sure how to fix it. Or just discard it? about the version of FastQC, it is just out of my control.

[GenoMax]

Best way would be to delete that record (4 lines) unless you want to try your luck with fastq-dump again to see if you can get a good copy. If this is paired end data be sure to delete the corresponding record in other file as well.