Question: Custom sequences vs supplied sequences in trimmomatric
0
gravatar for ofonov
4.0 years ago by
ofonov0
Norway/Oslo
ofonov0 wrote:

I would like to cut adapters in my PE data set with trimmomatic. The sequencing facility supplied two adapter sequences with the data:

Universal adapter:

5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'

Indexed adapter:

5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG-3'

The universal adapter is the same as PrefixPE/1 in supplied with trimmomatic file TruSeq2-PE. However there is nothing looking like Indexed adapter. According to trimmomatic manual there are two modes of trimming: 'simple' and 'palindrome'. Naming of the sequences in supplied .fa file affects how they are used:

For 'Palindrome' clipping, the sequence names should both start with 'Prefix', and end in '/1' for the forward adapter and '/2' for the reverse adapter. All other sequences are checked using 'simple' mode. Sequences with names ending in '/1' or '/2' will be checked only against the forward or reverse read. Sequences not ending in '/1' or '/2' will be checked against both the forward and reverse read. If you want to check for the reverse-complement of a specific sequence, you need to specifically include the reverse-complemented form of the sequence as well, with another name.

Provided that I have only listed above two sequences and no information about the other adapters/primers which were used during the library preparation/sequencing, how my .fa file with adapters should look like for trimmomatic?

trimming trimmomatic adapters • 1.3k views
ADD COMMENTlink modified 4.0 years ago by shunyip200 • written 4.0 years ago by ofonov0
1

If you don't want to worry about any of this just follow: C: Primer/adapter trimming for antibody sequencing data?

ADD REPLYlink written 4.0 years ago by GenoMax95k
0
gravatar for shunyip
4.0 years ago by
shunyip200
shunyip200 wrote:

Trimmomatic's manual also says:

With 'simple' trimming, each adapter sequence is tested against the reads, and if a sufficientlyaccurate match is detected, the read is clipped appropriately.

So, I believe you simply need to append:

>IndexAdapter

GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

into your TruSeq2-PE.fa file.

ADD COMMENTlink written 4.0 years ago by shunyip200
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2346 users visited in the last hour
_