Question: Confusion in SRA submission
0
gravatar for arunprasanna83
6 months ago by
arunprasanna8310 wrote:

Hello,

I am downloading an SRA data for a study. The study is basically, Illumina Paired data. However, the study description shows that, "This run has 2 reads per spot" and Reads section show the following:

Reads (separated)

>gnl|SRA|SRR768721.1.1 HWI-ST0798_0099:2:1101:1545:2240 (Biological) CCAGAATGCGCCCGGTGCATTCTGGGACTCCGAATCAGAAGAGGGAGTTGCGTCAGAGGC GGAGGTGGATGAAGCAGCGGGAGGAGAGGCGGAATCATCGG

>gnl|SRA|SRR768721.1.2 HWI-ST0798_0099:2:1101:1545:2240 (Biological) TACACTCGTAACCTCCTCGCCGCCAACCCCGACGTTCTTCAAGAGGGTGGTGCCATTGAC CTAAGCTCAATGTCCAGCNCNNNNNNNNNNNNNNNNNNNNN

Does this mean that, .1 & .2 represent the pairs and I should 'fastq-dump --split-files' to split them into two files ?

Thanks in Advance,

AP

rna-seq sra • 248 views
ADD COMMENTlink modified 6 months ago by genomax37k • written 6 months ago by arunprasanna8310
2
gravatar for genomax
6 months ago by
genomax37k
United States
genomax37k wrote:

That is correct. I suggest you make your task easy and download the fastq files from ENA here. No sratoolkit needed.

ADD COMMENTlink written 6 months ago by genomax37k

Wow. Thats cool ! I didn't know about this !

ADD REPLYlink written 6 months ago by arunprasanna8310

Always check ENA to see if fastq's are available. They generally are except for recent SRA submissions (which eventually appear).

ADD REPLYlink modified 6 months ago • written 6 months ago by genomax37k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1456 users visited in the last hour