Question: Confusion in SRA submission
0
gravatar for arunprasanna83
14 months ago by
arunprasanna8320 wrote:

Hello,

I am downloading an SRA data for a study. The study is basically, Illumina Paired data. However, the study description shows that, "This run has 2 reads per spot" and Reads section show the following:

Reads (separated)

>gnl|SRA|SRR768721.1.1 HWI-ST0798_0099:2:1101:1545:2240 (Biological) CCAGAATGCGCCCGGTGCATTCTGGGACTCCGAATCAGAAGAGGGAGTTGCGTCAGAGGC GGAGGTGGATGAAGCAGCGGGAGGAGAGGCGGAATCATCGG

>gnl|SRA|SRR768721.1.2 HWI-ST0798_0099:2:1101:1545:2240 (Biological) TACACTCGTAACCTCCTCGCCGCCAACCCCGACGTTCTTCAAGAGGGTGGTGCCATTGAC CTAAGCTCAATGTCCAGCNCNNNNNNNNNNNNNNNNNNNNN

Does this mean that, .1 & .2 represent the pairs and I should 'fastq-dump --split-files' to split them into two files ?

Thanks in Advance,

AP

rna-seq sra • 496 views
ADD COMMENTlink modified 14 months ago by genomax51k • written 14 months ago by arunprasanna8320
2
gravatar for genomax
14 months ago by
genomax51k
United States
genomax51k wrote:

That is correct. I suggest you make your task easy and download the fastq files from ENA here. No sratoolkit needed.

ADD COMMENTlink written 14 months ago by genomax51k

Wow. Thats cool ! I didn't know about this !

ADD REPLYlink written 14 months ago by arunprasanna8320

Always check ENA to see if fastq's are available. They generally are except for recent SRA submissions (which eventually appear).

ADD REPLYlink modified 14 months ago • written 14 months ago by genomax51k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 817 users visited in the last hour