Question: Confusion in SRA submission
0
gravatar for arunprasanna83
2.1 years ago by
arunprasanna8330 wrote:

Hello,

I am downloading an SRA data for a study. The study is basically, Illumina Paired data. However, the study description shows that, "This run has 2 reads per spot" and Reads section show the following:

Reads (separated)

>gnl|SRA|SRR768721.1.1 HWI-ST0798_0099:2:1101:1545:2240 (Biological) CCAGAATGCGCCCGGTGCATTCTGGGACTCCGAATCAGAAGAGGGAGTTGCGTCAGAGGC GGAGGTGGATGAAGCAGCGGGAGGAGAGGCGGAATCATCGG

>gnl|SRA|SRR768721.1.2 HWI-ST0798_0099:2:1101:1545:2240 (Biological) TACACTCGTAACCTCCTCGCCGCCAACCCCGACGTTCTTCAAGAGGGTGGTGCCATTGAC CTAAGCTCAATGTCCAGCNCNNNNNNNNNNNNNNNNNNNNN

Does this mean that, .1 & .2 represent the pairs and I should 'fastq-dump --split-files' to split them into two files ?

Thanks in Advance,

AP

rna-seq sra • 783 views
ADD COMMENTlink modified 2.1 years ago by genomax68k • written 2.1 years ago by arunprasanna8330
2
gravatar for genomax
2.1 years ago by
genomax68k
United States
genomax68k wrote:

That is correct. I suggest you make your task easy and download the fastq files from ENA here. No sratoolkit needed.

ADD COMMENTlink written 2.1 years ago by genomax68k

Wow. Thats cool ! I didn't know about this !

ADD REPLYlink written 2.1 years ago by arunprasanna8330

Always check ENA to see if fastq's are available. They generally are except for recent SRA submissions (which eventually appear).

ADD REPLYlink modified 2.1 years ago • written 2.1 years ago by genomax68k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 954 users visited in the last hour