Question: Confusion in SRA submission
0
gravatar for arunprasanna83
18 months ago by
arunprasanna8330 wrote:

Hello,

I am downloading an SRA data for a study. The study is basically, Illumina Paired data. However, the study description shows that, "This run has 2 reads per spot" and Reads section show the following:

Reads (separated)

>gnl|SRA|SRR768721.1.1 HWI-ST0798_0099:2:1101:1545:2240 (Biological) CCAGAATGCGCCCGGTGCATTCTGGGACTCCGAATCAGAAGAGGGAGTTGCGTCAGAGGC GGAGGTGGATGAAGCAGCGGGAGGAGAGGCGGAATCATCGG

>gnl|SRA|SRR768721.1.2 HWI-ST0798_0099:2:1101:1545:2240 (Biological) TACACTCGTAACCTCCTCGCCGCCAACCCCGACGTTCTTCAAGAGGGTGGTGCCATTGAC CTAAGCTCAATGTCCAGCNCNNNNNNNNNNNNNNNNNNNNN

Does this mean that, .1 & .2 represent the pairs and I should 'fastq-dump --split-files' to split them into two files ?

Thanks in Advance,

AP

rna-seq sra • 610 views
ADD COMMENTlink modified 18 months ago by genomax58k • written 18 months ago by arunprasanna8330
2
gravatar for genomax
18 months ago by
genomax58k
United States
genomax58k wrote:

That is correct. I suggest you make your task easy and download the fastq files from ENA here. No sratoolkit needed.

ADD COMMENTlink written 18 months ago by genomax58k

Wow. Thats cool ! I didn't know about this !

ADD REPLYlink written 18 months ago by arunprasanna8330

Always check ENA to see if fastq's are available. They generally are except for recent SRA submissions (which eventually appear).

ADD REPLYlink modified 18 months ago • written 18 months ago by genomax58k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 981 users visited in the last hour