Odd reads from RAD seq

Question

[millan.anamar]

Hello all, I´m trying to align RAD seq reads to de novo in Bowtie2, but I get the next problem:

Warning: Could not open read file "Spa.vir_CAR147_1.fastq" for reading; skipping...
Warning: Could not open read file "Spa.vir_CAR153_1.fastq" for reading; skipping...
Warning: Could not open read file "Spa.vir_CAR154_1.fastq" for reading; skipping...
Error: No input read files were valid
(ERR): bowtie2-align exited with value 1

I saw the reads with the command head, and the reads looks like this

@SN747:516:C8M5TACXX:1:2210:2138:56104 1:N:0:1
TGCAGGGATCTTTCTCTCCCAGCAGACCCTCTGTTATTTTTACAAAATATACTCTCCAGAGACTTTGATGTGTAGGATTTCAGTTATTGTG
+
HHHJJJJJJJIJJJJJJJJJJIJIJJJJJJJJJJIJJJJJJJJIJJJJJJJJJJJJGHHHHFFFFDFEEEFEDDCDCCDDDDDFEDEDDEC
@SN747:516:C8M5TACXX:1:2210:2166:56214 1:N:0:1
TGCAGGTTCAGCGTGGAGTCTGGGTACAGCTCCTCTCCCTGTGAGCCGGCCCACCTCACTGCTGCTGTACCGGACTGACTCCTCAGACTCC
+
HHHJJJGJJJJJJHIIJJHHIIJIDHIJJIJHIIJJJJJIJGIIJJJJEHFDDDDDDDDDDCDDDACDDDDDDDDDDDDDDDDDDDDDDDD

I´m very new in NGS. Please somebody could explain me, what is exactly the issue with the reads? Thank you so much

Answer 1

[GenoMax]

The reads are fine/normal.

It appears that bowtie2 is unable to read your sequence files. This may simply be a problem of providing correct file paths (full or relative). Since you did not include the original command line used in this case try adding correct paths to that line.

Answer 2

[millan.anamar]

Thank you! I will try it, again