Labeling features in a sequence from a feature list?
0
0
Entering edit mode
4.0 years ago
npatel89 • 0

Hello,

I'm just starting out with Biopython. I have a table of DNA sequence features which I want to use to annotate unlabelled genbank sequence files. Is there an easy way to do this, or should I just code up something custom for myself? I feel like someone must have tried this.

Thanks!

Biopython Sequence Features python • 709 views
ADD COMMENT
0
Entering edit mode

What does your table of features look like? Sequences or co-ordinates etc? You need to show us a sample of what what your input data looks like.

ADD REPLY
0
Entering edit mode

Example feature list:

Feature1 ATTAACCCTCACTAAAGGGA

Feature2 TGTAAAACGACGGCCAGT

Feature3 CAGGAAACAGCTATGACCATG

Feature4 TAATACGACTCACTATAGGG

Feature5 ATTTAGGTGACACTATAG

They are just sequences and I want to find all feature coordinates that may or may not exist in an unlabelled plasmid sequence file.

ADD REPLY
0
Entering edit mode

The cloning software SnapGene has this feature. I can't recall if it's available in the free version, but give it a try.

ADD REPLY

Login before adding your answer.

Traffic: 1600 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6