Entering edit mode
8.3 years ago
rkacharya1337
▴
20
I have multiplexed Fastq files which have barcodes appended to the end of the identifier line rather than on the sequence line. The data did not come with a 3rd barcode fastq that some tools require. Is there a simple available tool or approach to demultiplex these files and deal with some errors in the barcode?
Example:
@K00156:138:HGVJ2BBXX:1:1101:1742:1033 1:N:0:NAGATCAT
NTCAGACCGCGTTCTCTCCCTCTCACTCCCCANTACGGAGAGAAGAACGATCATCAATGGCTGACGGCAGTTGCAGCCAAGCAACGCCAGAAAGCCGGCTT
+
#AAFFJJJJJJJFJJFJJJJFJJJJJJJJFJJ#JJJJJJJJFJJJJJJJJJJJJJJJJJAJJ7AJ<<JFJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJ
Use solutions offered by @Brian or @Pierre here: Splitting a fasta file on the basis of header barcodes or A: Demultiplexing fastq files with dual barcodes