Question: Ensembl and Aceview - difference in the UTR sequence
0
gravatar for DanielC
21 months ago by
DanielC90
Canada
DanielC90 wrote:

Dear All,

Can someone please help me to understand why is there difference in the sequences length (below) for the 5' UTR of BRCA2 from two sources "Aceview" and "Ensembl"? and which one is the reasonable to be used for any analysis to be done?

From "Aceview": https://www.ncbi.nlm.nih.gov/ieb/research/acembly/av.cgi?db=human&term=brca2&submit=Go

>BRCA2.aAug10.mRNA_fragment from 1 to 237, length 237 bp 
>mRNA BRCA2.aAug10, bp 1 to 237 with coding in upper case and exons in alternate colors
 gcgcgggctt**gtggcgcgagcttctgaaactaggcggcagaggcggagccgctgtggcactgctgcgcctctgctgcgcctcgggtgtcttttgcggcgg
tgggtcgccgccgggagaagcgtgaggggacagatttgtgaccggcgcggtttttgtcagcttactccggccaaaaaagaactgcacctctggagcgg**ac
ttatttaccaagcattggaggaatatcgtaggtaaaa

From "Ensembl": http://rest.ensembl.org/lookup/id/NM_000059.3?content-type=application/json;expand=1;utr=1

>hg38:chr13:32315480-32315667
**GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCT
CTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGA
CAGATTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTC
TGGAGCGG**

>hg38:chr13:32316422-32316460
ACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAAA

The bolds ones in both sequences match. but the sequence from "Aceview" has longer 5' UTR than "Ensembl". Also, "Ensembl" shows two 5' UTRs, whereas, "Aceview" shows just one 5' UTR.

Thanks much!

sequence genome • 467 views
ADD COMMENTlink modified 10 days ago by Biostar ♦♦ 20 • written 21 months ago by DanielC90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 923 users visited in the last hour