Ensembl and Aceview - difference in the UTR sequence
0
0
Entering edit mode
4.2 years ago
DanielC ▴ 140

Dear All,

Can someone please help me to understand why is there difference in the sequences length (below) for the 5' UTR of BRCA2 from two sources "Aceview" and "Ensembl"? and which one is the reasonable to be used for any analysis to be done?

From "Aceview": https://www.ncbi.nlm.nih.gov/ieb/research/acembly/av.cgi?db=human&term=brca2&submit=Go

>BRCA2.aAug10.mRNA_fragment from 1 to 237, length 237 bp 
>mRNA BRCA2.aAug10, bp 1 to 237 with coding in upper case and exons in alternate colors
 gcgcgggctt**gtggcgcgagcttctgaaactaggcggcagaggcggagccgctgtggcactgctgcgcctctgctgcgcctcgggtgtcttttgcggcgg
tgggtcgccgccgggagaagcgtgaggggacagatttgtgaccggcgcggtttttgtcagcttactccggccaaaaaagaactgcacctctggagcgg**ac
ttatttaccaagcattggaggaatatcgtaggtaaaa

From "Ensembl": http://rest.ensembl.org/lookup/id/NM_000059.3?content-type=application/json;expand=1;utr=1

>hg38:chr13:32315480-32315667
**GTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCT
CTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGA
CAGATTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTC
TGGAGCGG**

>hg38:chr13:32316422-32316460
ACTTATTTACCAAGCATTGGAGGAATATCGTAGGTAAAA

The bolds ones in both sequences match. but the sequence from "Aceview" has longer 5' UTR than "Ensembl". Also, "Ensembl" shows two 5' UTRs, whereas, "Aceview" shows just one 5' UTR.

Thanks much!

sequence genome • 903 views
ADD COMMENT

Login before adding your answer.

Traffic: 2308 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6