PBSuite spots ambiguous insertion output value

Question

[Medhat]

Hi, I am using PBSuite version 15.8.24

Honey.py spots was used to identify structure variations.

here is one line of the output showing insertion, my question is: the insertion should be in one point in the genome, so how the output contains start and end ? (does the software add the size to satrt point to find the end point? is there a shift in all genome based on that)

1       1211650 1211854 INS     353     zscore=-11.943;szMean=353.000;sz3rdQ=550.000;szCount=5.000;strandCnt=2,3;szMedian=547.000;groupName=1;coverage=14.000;sz1stQ=60.000;mqfilt=0.000

also I visited similar question in https://sourceforge.net/p/pb-jelly/discussion/pbhtiks/thread/9b263cf1/

but the output in this post is;

lambda_NEB3011 29999 29999 INS 86 zscore=-15.744;GT=1/1;seq=ATTTTCACAAGCGTTATCTTTTACAAAACCGATCTCACTCTCCTTTGATGCGAATGCCAGCGTCAGACATCATATGCAGATACTCA;szMean=89.000;szCount=16.000;sz3rdQ=96.000;consensusCreated=1.000;strandCnt=7,9;szMedian=90.000;groupName=lambda_NEB3011;coverage=16.000;sz1stQ=78.000;mqfilt=0.000;GQ=7.321

were the start and end point is the same 29999.

is there any explanation?

Thanks