Question: Trimmomatic not displaying summary
0
gravatar for kiddodoraemon
11 days ago by
kiddodoraemon10 wrote:

Hello all, i am a beginner in this field. i'm grateful for your advice and help : i was running Trimmomatic0.36 on terminal using my macbook. however i couldnt find the "input read data..surviving reads...dropped reads..." summary lines on finishing the task. instead the display finished off like this:

Multiple cores found: Using 4 threads
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences

Here's my script: (I also try a simple script without the for loop but i didnt get the summary data either)

curl -O http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/Trimmomatic-0.36.zip
unzip Trimmomatic-0.36.zip
#!/bin/bash
for f1 in *_1.fastq.gz
do
withpath="${f1}"
filename=${withpath##*/}
base="${filename%*_*.fastq.gz}"
echo "${base}"
java -jar ./Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 -trimlog trimmoatic.log "${base}"*_1.fastq.gz "${base}"*_2.fastq.gz "${base}"_1.trimmed.1P.fastq.gz "${base}"_1.trimmed.1U.fastq.gz "${base}"_2.trimmed.2P.fastq.gz "${base}"_2.trimmed.2U.fastq.gz ILLUMINACLIP:./Trimmomatic-0.36/adapters/NexteraPE-PE.fa:2:30:10 LEADING:10 TRAILING:10 SLIDINGWINDOW:20:20 MINLEN:50
done

how could i get the summary lines regarding surviving reads, reads dropped etc? Thanks a lot!

rna-seq trimmomatic • 142 views
ADD COMMENTlink modified 11 days ago by Kevin Blighe6.8k • written 11 days ago by kiddodoraemon10
2
gravatar for Kevin Blighe
11 days ago by
Kevin Blighe6.8k
Republic of Ireland (√Čire)
Kevin Blighe6.8k wrote:

Hey kiddodoraemon,

I have edited your question to make he code more legible. When posting code or output from a command, highlight the text and then press the '101 010' button.

I have just tested trimmomatic (same version as yours) on my OS (Ubuntu 14.04) and it outputs the surviving reads, etc.to my terminal when the run completes.

I execute in a bash script with the following:

#!/bin/bash

paste files.list | while read fastq
do
    java -jar ./Trimmomatic-0.36/trimmomatic-0.36.jar SE -phred33 -trimlog MyTrimming.log "${fastq}" . ILLUMINACLIP:./Trimmomatic-0.36/adapters/NexteraPE-PE.fa:2:30:10 LEADING:10 TRAILING:10 SLIDINGWINDOW:20:20 MINLEN:50
done

files.list just contains my FASTQ files (1 per line). As you have paired end, you should be able to run it as:

#!/bin/bash

paste mates1.list mates2.list | while read P1 P2
do
    java -jar ./Trimmomatic-0.36/trimmomatic-0.36.jar PE -phred33 -trimlog MyTrimming.log "${P1}" "${P2}" et cetera...
done


Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 1444735 Surviving: 1443542 (99,92%) Dropped: 1193 (0,08%)
TrimmomaticSE: Completed successfully
ADD COMMENTlink modified 11 days ago • written 11 days ago by Kevin Blighe6.8k
1

Thanks very much Kevin Blighe! its simpler and it works!

ADD REPLYlink written 11 days ago by kiddodoraemon10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 929 users visited in the last hour