Hi I would like to output all the subject line from the alignment with blastn. When I BLAST using NCBI webpage, I can download all the aligned sequences in FASTA form. With this I can later input into my code in R for further analysis. I want to do the same thing with my blastn in windows, where I can extract all the subject line (bolded) in a fasta form.
SSTP_scaffold0000007 length=368211 Length=368211
Score = 46.4 bits (50), Expect = 2e-006 Identities = 25/25 (100%), Gaps = 0/25 (0%) Strand=Plus/Minus
Query 1 TGTTTATGTGAACTTACtttttttG 25
|||||||||||||||||||||||||
Sbjct 104524 TGTTTATGTGAACTTACTTTTTTTG 104500
Just for others for clarification: you have to do the filtering in Windows? Have you ever tried Cygwin (to use
grep)?; linux virtual machine?; or just the basic (and free) EC2 instance from Amazon Web Services?Hi Kevin, thank you so much for your suggestion, I will look at those options, I initially wanted to do in Windows because I haven't got much experience with Linux and such, but I will make sure to give these a try.