Question: Mate negative strand flag does not match read negative strand flag of mate
0
gravatar for user230613
2.2 years ago by
user230613280
Europe
user230613280 wrote:

I get this error when running picard ValidateSamFile in a RNA-Seq bam file produced by hisat2:

ERROR: Record 52, Read name K00103:277:HL7HMBBXX:6:2109:23551:26054, Mate negative strand flag does not match read negative strand flag of mate

This is the read in the bam file:

samtools view -@ 12 hisat2_sort.bam | grep "K00103:277:HL7HMBBXX:6:2109:23551:26054"

K00103:277:HL7HMBBXX:6:2109:23551:26054 69  1   3747256 0   *   =   3747256 0   CTGGCTACACAAACAGGACCCAACATTCTGCTGCTTACAGGAAACCCATCTCAGGGAAAAAGACAGACACTACCT AAFFFJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJFJJFJJJJJJJJJJJJJJJFJJJJJJJJ YT:Z:UP RG:Z:F72_tumor_R1
K00103:277:HL7HMBBXX:6:2109:23551:26054 153 1   3747256 60  75M =   3747256 0   ATTGACCATATAATTGGTCACAAAATAGGCCTCAACAGAAACAAAAATATTGAAATTGTCCCATGTATCCTATCA JFJFJJJAFJJ<JFA7F<F<F<FJ-<AAA<-<7FJ<A-J-J<JJJF<FJFJJJJJJJJJJJJJJJJJJJFFFFA< AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:75 YT:Z:UP NH:i:1  RG:Z:F72_tumor_R1

I don't know what's going on and I need to fix this.

Any help would be appreciated.

:)

validatesamfile bam rnaseq • 810 views
ADD COMMENTlink modified 2.2 years ago by Santosh Anand5.0k • written 2.2 years ago by user230613280
0
gravatar for Santosh Anand
2.2 years ago by
Santosh Anand5.0k
Santosh Anand5.0k wrote:

Sam specification says that If a SAM record has the negative strand flag (0x10) set, then it's mate should have the mate negative strand flag (0x20) set. In your case, flag 153 has 0x10 set, but flag 69 doesn't contain 0x20.

ADD COMMENTlink written 2.2 years ago by Santosh Anand5.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1958 users visited in the last hour