Entering edit mode
7.4 years ago
fufuyou
▴
110
Hello, I have lots of sequences from two parts: one is
>seqeunce1
ATGTGTGTTGTACAACTTTGGTATATACTGTATATACC42327477R_3222148F_10594369R_21575807R_1679947F_28391165R
other is
>42327477R_3222148F_10594369R_21575807R_1679947F_28391165R
TGTGTTGTACAACTTTGGTATATACTGTATATACC
I want to get the sequence like as following:
>seqeunce1
ATGTGTGTTGTACAACTTTGGTATATACTGTATATACC*TGTGTTGTACAACTTTGGTATATACTGTATATACC*
Could you have some methods for doing this? Thanks, Fuyou
Hi,
Can you explain your issue a little more in detail? Do you want that code at the end replaced by the sequence from the other file? Or look whether seq2 matches seq1 and then concatenate them? (or are these equivalents of each other? == the code denotes seq2 is part of seq1?)
Thanks. yes. I want to use seq2's sequence to replace the code in seq1. Fuyou
is it correct to assume you have 2 files with all these sequences in? or a whole bunch of separate files?
Yes. I have two files and all sequences in two files. Thanks, Fuyou