Question: Renaming .fa file genes back to its repeat masker file origin
0
gravatar for Noob
8 months ago by
Noob0
Noob0 wrote:

I had a repeat masker bed file that I used to extract particular sections from a genome I am working with, using Bedtools. However, my output file (.fa) named the individual segments "unspecified" and then a number, so I can not relate the genes back to their coordinates from the repeat masker file. How can edit the output file to correlate with the original bed file? Or is there a way I can redo this so that it will give me a more specific output? Thank you

sequencing gene sequence R genome • 228 views
ADD COMMENTlink written 8 months ago by Noob0

It would be helpful to debug/reproduce the error if you could specify the exact commands you used and also give an excerpt of your data.

ADD REPLYlink written 8 months ago by RamRS19k

I used:

bedtools getfasta -name -s -fi file.fa -bed rmsk.bed -fo GeneResults.fa

and an example of a data point was:

>rnd-4_family-798_Unspecified(-)
TTGATATCAGAAGGTTTTTCTATGCCTGTTTTGTAAAGGTGGATTTAATCTTGATATTAAAGGATTGTTTTTGCAAGCTTAAATGCGAACCTCATAGTGCGTAAACTGCATAGTTAAATTTACCATTGTTTCAAGCTTTCATGGTTTA 
ADD REPLYlink modified 8 months ago by RamRS19k • written 8 months ago by Noob0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1394 users visited in the last hour