Renaming .fa file genes back to its repeat masker file origin
0
0
Entering edit mode
3.2 years ago
Noob • 0

I had a repeat masker bed file that I used to extract particular sections from a genome I am working with, using Bedtools. However, my output file (.fa) named the individual segments "unspecified" and then a number, so I can not relate the genes back to their coordinates from the repeat masker file. How can edit the output file to correlate with the original bed file? Or is there a way I can redo this so that it will give me a more specific output? Thank you

R genome sequencing gene sequence • 687 views
ADD COMMENT
0
Entering edit mode

It would be helpful to debug/reproduce the error if you could specify the exact commands you used and also give an excerpt of your data.

ADD REPLY
0
Entering edit mode

I used:

bedtools getfasta -name -s -fi file.fa -bed rmsk.bed -fo GeneResults.fa

and an example of a data point was:

>rnd-4_family-798_Unspecified(-)
TTGATATCAGAAGGTTTTTCTATGCCTGTTTTGTAAAGGTGGATTTAATCTTGATATTAAAGGATTGTTTTTGCAAGCTTAAATGCGAACCTCATAGTGCGTAAACTGCATAGTTAAATTTACCATTGTTTCAAGCTTTCATGGTTTA 
ADD REPLY

Login before adding your answer.

Traffic: 2643 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6