Entering edit mode
7.4 years ago
jaqx008
▴
110
Hello Guys, This is not much of a computation question. I made this count table bar graphs for siRNA I have from RNAseq data of a female organism. overral, the siRNA was low for all BUT ONE loci. Im trying to identify the mRNA regulated by this one siRNA (ACCCATAGATCCGAGCTTGTG) but dont know how to go about this. Also, I am open to any suggestion as to what is happening at this one loci. 
Does your organism have a known transcriptome? If not, is there a decently well studied related organism? Worst case scenario you can just blast your sequence against a related transcriptome and see what it hits.
Thanks. My organism (lancelet) does not have a well anotated genome. I did blast the 21nt sequence and got a protein that I assume should correspond to were the siRNA regulate. I used this protein to blast a related specie (Homo sapien or mouse). and got
I wasnt sure I was doing the right thing.