Needing help with a Count table Graph
0
0
Entering edit mode
7.3 years ago
jaqx008 ▴ 110

Hello Guys, This is not much of a computation question. I made this count table bar graphs for siRNA I have from RNAseq data of a female organism. overral, the siRNA was low for all BUT ONE loci. Im trying to identify the mRNA regulated by this one siRNA (ACCCATAGATCCGAGCTTGTG) but dont know how to go about this. Also, I am open to any suggestion as to what is happening at this one loci. siRNA image below

siRNA Counttable mapping loci ID • 1.2k views
ADD COMMENT
0
Entering edit mode

Does your organism have a known transcriptome? If not, is there a decently well studied related organism? Worst case scenario you can just blast your sequence against a related transcriptome and see what it hits.

ADD REPLY
0
Entering edit mode

Thanks. My organism (lancelet) does not have a well anotated genome. I did blast the 21nt sequence and got a protein that I assume should correspond to were the siRNA regulate. I used this protein to blast a related specie (Homo sapien or mouse). and got

BCAT_beta_family    cd01557 
BCAT_beta_family: Branched-chain aminotransferase catalyses the transamination of the ...
24-319  4.54e-126
PRK13357    PRK13357    
branched-chain amino acid aminotransferase; Provisional
1-330   8.69e-126
ilvE_II TIGR01123   
branched-chain amino acid aminotransferase, group II; Among the class IV aminotransferases are ...
12-326  8.31e-97
IlvE    COG0115 
Branched-chain amino acid aminotransferase/4-amino-4-deoxychorismate lyase [Amino acid ...
11-321  7.47e-60
Aminotran_4 pfam01063   
Amino-transferase class IV; The D-amino acid transferases (D-AAT) are required by bacteria to ...

I wasnt sure I was doing the right thing.

ADD REPLY

Login before adding your answer.

Traffic: 3230 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6