Trimmomatic Error: Unable to detect quality encoding
1
0
Entering edit mode
2.7 years ago

Hi,

I am having trouble deciphering why I am getting this error using trimmomatic. I did not have this error before, so I am confused as to why it is occurring. Trimmomatic works for some of the samples, but it does not work with the rest of the samples. This is my code:

rule trim_illumina_Adaptors_fastqs:
 input: readWD + 'symlinks/{samp}_R1.fastq.gz', readWD + 'symlinks/{samp}_R2.fastq.gz', 
 output: 'symlinks/{samp}_R1.PAIREDtrimmomatictrimmed.fastq.gz', 'symlinks/{samp}_R1.UNPAIREDtrimmomatictrimmed.fastq.gz', 'symlinks/{samp}_R2.PAIREDtrimmomatictrimmed.fastq.gz', 'symlinks/{samp}_R2.UNPAIREDtrimmomatictrimmed.fastq.gz',  
 shell: 'trimmomatic PE -threads 12 -trimlog symlinks/trim_log.txt {input[0]} {input[1]} {output[0]} {output[1]} {output[2]} {output[3]} ILLUMINACLIP:/nas/longleaf/apps/trimmomatic/0.36/Trimmomatic-0.36/adapters/TruSeq3-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36'

And this is my error message:

[Fri Jul 27 15:28:04 2018] rule trim_illumina_Adaptors_fastqs:
[Fri Jul 27 15:28:04 2018] input: symlinks/OM015_2014-09-10_R1.fastq.gz, symlinks/OM015_2014-09-10_R2.fastq.gz
[Fri Jul 27 15:28:04 2018] output: symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz
[Fri Jul 27 15:28:04 2018] jobid: 0
[Fri Jul 27 15:28:04 2018] wildcards: ds=OM015_2014-09-10

TrimmomaticPE: Started with arguments:
 -threads 12 -trimlog symlinks/trim_log.txt symlinks/OM015_2014-09-10_R1.fastq.gz symlinks/OM015_2014-09-10_R2.fastq.gz symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz ILLUMINACLIP:/nas/longleaf/apps/trimmomatic/0.36/Trimmomatic-0.36/adapters/TruSeq3-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Error: Unable to detect quality encoding
[Fri Jul 27 15:28:05 2018] Error in rule trim_illumina_Adaptors_fastqs:
[Fri Jul 27 15:28:05 2018] jobid: 0
[Fri Jul 27 15:28:05 2018] output: symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz, symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz

[Fri Jul 27 15:28:05 2018] RuleException:
[Fri Jul 27 15:28:05 2018] CalledProcessError in line 144 of /pine/scr/p/a/parkz/TROUBLESHOOTING/Pv_R_ASAPandCMP_3/Pv_Snaligner.py:
[Fri Jul 27 15:28:05 2018] Command ' set -euo pipefail;  trimmomatic PE -threads 12 -trimlog symlinks/trim_log.txt symlinks/OM015_2014-09-10_R1.fastq.gz symlinks/OM015_2014-09-10_R2.fastq.gz symlinks/OM015_2014-09-10_R1.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R1.UNPAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.PAIREDtrimmomatictrimmed.fastq.gz symlinks/OM015_2014-09-10_R2.UNPAIREDtrimmomatictrimmed.fastq.gz ILLUMINACLIP:/nas/longleaf/apps/trimmomatic/0.36/Trimmomatic-0.36/adapters/TruSeq3-PE.fa:2:30:10:8:TRUE LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 ' returned non-zero exit status 1.
[Fri Jul 27 15:28:05 2018] File "/pine/scr/p/a/parkz/TROUBLESHOOTING/Pv_R_ASAPandCMP_3/Pv_Snaligner.py", line 144, in __rule_trim_illumina_Adaptors_fastqs
[Fri Jul 27 15:28:05 2018] File "/proj/ideel/apps/linuxbrew/opt/python/lib/python3.7/concurrent/futures/thread.py", line 57, in run
[Fri Jul 27 15:28:05 2018] Shutting down, this might take some time.
[Fri Jul 27 15:28:05 2018] Exiting because a job execution failed. Look above for error message

This seems to be the problem:

Error: Unable to detect quality encoding

But I am unable to diagnose the problem with my limited background in coding.

Whether I send the script off as a job on the cluster or I modify the script and run it on the command line, I still get the same error.

Does anyone have any suggestions?

Thank you!

alignment genome sequencing next-gen • 2.3k views
ADD COMMENT
0
Entering edit mode

Hello,

could you please post the fastq data for the first few reads? We should check how the quality values look like.

fin swimmer

ADD REPLY
1
Entering edit mode
2.7 years ago
h.mon 32k

Trimmomatic uses the first few thousand reads to guess the Phred encoding of the file, looking for unique characters from the Phred+33 or Phred+64 set. If it can't find, it will throw this error. You can pass the encoding on the command-line with the parameters -phred33 or -phred64.

ADD COMMENT

Login before adding your answer.

Traffic: 1177 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6