Extract SNP flanking Sequence based on locations from reference fasta file

Question

[pramodkp97]

I have a list of SNP location in a file.

Chromosome position
chr01 2387766 
chr01 7894895
chr01 9090373
chr02 1103
chr02 15118
chr03 160115
chr03 17804
chr04 190961
chr04 19573921
chr04 20867534

Now I want to extract SNP sequence along with flanking sequence of 200 bases. Output example: ACGTTGTCTTCAAGCTAAAGGCTCGTGGAATGAATGCGGC[G/A]GATCTCGGAAAACTTGGAAGATCAACTACTTTGAAAAGT

Reference genome file is present as a refernceGenome.fasta. How do i go about it.

[Pierre Lindenbaum]

duplicate of Get Flanking Sequence Given A List Of Positions

[pramodkp97]

There they are finding SNP from human genome which is supported in ENSEMBLE & UCSC database but in my case the genome is not annnotated and it is locally present in a fasta file. So i feel in this case i need some other way to get the flanking sequence.

[finswimmer]

• bedtools flank
• bedtools getfasta

[Pierre Lindenbaum]

and it is locally present in a fasta file

A: Get Flanking Sequence Given A List Of Positions