Extract SNP flanking Sequence based on locations from reference fasta file
0
0
Entering edit mode
2.7 years ago
pramodkp97 • 0

I have a list of SNP location in a file.

Chromosome position
chr01 2387766 
chr01 7894895
chr01 9090373
chr02 1103
chr02 15118
chr03 160115
chr03 17804
chr04 190961
chr04 19573921
chr04 20867534

Now I want to extract SNP sequence along with flanking sequence of 200 bases. Output example: ACGTTGTCTTCAAGCTAAAGGCTCGTGGAATGAATGCGGC[G/A]GATCTCGGAAAACTTGGAAGATCAACTACTTTGAAAAGT

Reference genome file is present as a refernceGenome.fasta. How do i go about it.

genome sequence SNP flanking next-gen • 1.7k views
ADD COMMENT
0
Entering edit mode
ADD REPLY
0
Entering edit mode

There they are finding SNP from human genome which is supported in ENSEMBLE & UCSC database but in my case the genome is not annnotated and it is locally present in a fasta file. So i feel in this case i need some other way to get the flanking sequence.

ADD REPLY
0
Entering edit mode

and it is locally present in a fasta file

A: Get Flanking Sequence Given A List Of Positions

ADD REPLY
0
Entering edit mode
ADD REPLY

Login before adding your answer.

Traffic: 1054 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6