Question: Extract SNP flanking Sequence based on locations from reference fasta file
0
gravatar for pramodkp97
18 months ago by
pramodkp970
pramodkp970 wrote:

I have a list of SNP location in a file.

Chromosome position
chr01 2387766 
chr01 7894895
chr01 9090373
chr02 1103
chr02 15118
chr03 160115
chr03 17804
chr04 190961
chr04 19573921
chr04 20867534

Now I want to extract SNP sequence along with flanking sequence of 200 bases. Output example: ACGTTGTCTTCAAGCTAAAGGCTCGTGGAATGAATGCGGC[G/A]GATCTCGGAAAACTTGGAAGATCAACTACTTTGAAAAGT

Reference genome file is present as a refernceGenome.fasta. How do i go about it.

ADD COMMENTlink written 18 months ago by pramodkp970

duplicate of Get Flanking Sequence Given A List Of Positions

ADD REPLYlink written 18 months ago by Pierre Lindenbaum125k

There they are finding SNP from human genome which is supported in ENSEMBLE & UCSC database but in my case the genome is not annnotated and it is locally present in a fasta file. So i feel in this case i need some other way to get the flanking sequence.

ADD REPLYlink written 18 months ago by pramodkp970

and it is locally present in a fasta file

A: Get Flanking Sequence Given A List Of Positions

ADD REPLYlink written 18 months ago by Pierre Lindenbaum125k
ADD REPLYlink written 18 months ago by finswimmer13k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 607 users visited in the last hour