Question: Problems running Trinity 2.6.6.
0
gravatar for Guillermo D. Huerta
13 months ago by
Columbus (Ohio)
Guillermo D. Huerta10 wrote:

Hi all,

I'm trying to run Trinity (2.6.6.) to analyze a metatranscriptome, but it is giving me the following errors:

Error, pairs.K25.stats is empty.  Be sure to check your fastq reads and ensure that the read names are identical except for the /1 or /2 designation. at /fs/project/PAS1117/modules/trinity/2.6.6/util/insilico_read_normalization.pl line 921.
CMD finished (1209 seconds)
Error, cmd: /fs/project/PAS1117/modules/trinity/2.6.6/util/insilico_read_normalization.pl --seqType fq --JM 112G  --max_cov 50 --min_cov 1 --CPU 28 --output /fs/project/PAS1117/GuiDH/Trinity_tests/trinity_out_dir/insilico_read_normalization   --max_pct_stdev 10000  --left /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_1.fastq.gz --right /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_2.fastq.gz --pairs_together --PARALLEL_STATS   **died with ret 512 at /fs/project/PAS1117/modules/trinity/2.6.6/Trinity line 2581.
        main::process_cmd('/fs/project/PAS1117/modules/trinity/2.6.6/util/insilico_read_...') called at /fs/project/PAS1117/modules/trinity/2.6.6/Trinity line 3127
        main::normalize('/fs/project/PAS1117/GuiDH/Trinity_tests/trinity_out_dir/insil...', 50, 'ARRAY(0x2735d58)', 'ARRAY(0x277bb80)') called at /fs/project/PAS1117/modules/trinity/2.6.6/Trinity line 3074

Could someone check if there is something wrong with the batch file sent? (pasted here below)

#PBS -N trinity_test3
#PBS -l walltime=40:00:00
#PBS -l nodes=1:ppn=48
#PBS -j oe
#PBS -m abe
#PBS -A PAA0034
set -x
cd $PBS_O_WORKDIR
module use /fs/project/PAS1117/modulefiles
module load samtools/1.3.1
module load bowtie2/2.2.9
module load jellyfish/2.2.9
module load salmon/0.9.1
module load trinity/2.6.6
Trinity --seqType fq --left /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_1.fastq.gz --right /fs/project/PAS1117/Tara_Euk/upwelling-v2/ERR1719296_2.fastq.gz --CPU 28 --max_memory 112G
echo $PBS_JOBID
echo $PBS-JOBNAME

Thank you!

ADD COMMENTlink modified 13 months ago by h.mon27k • written 13 months ago by Guillermo D. Huerta10

Maybe a problem with fastq headers: Trinity v2.4.0 error ret 512 at ./Trinity line 2462. See also

How do I use reads I downloaded from SRA?

Another debbuging hint: Error, pairs.K25.stats is empty;

ADD REPLYlink modified 13 months ago • written 13 months ago by h.mon27k

Hi,

thanks very much for your answer!

If you have a look to the top lines of the (right) fastq.gz file, would you say that is a matter of format?

@H10C:D1D8LACXX:2:1101:1390:2131_F/1
CTTTCGTACTAAAAACAATAAATCTCACTCTATAAGATAGAAACCAATCTAGCTTTCGCCGATCTGAACTCAAATCATGTAAAAATTTAAAA
+ERR1719154.1.1 H10C:D1D8LACXX:2:1101:1390:2131 length=92
ABD>D?CFBF<FAAEFIEIEFIA9CHG9CC@EGFDF@?C?BFDF;?;B??BF4//=8-7@;@<EBB))76;A@CACB>A5(5;B39>5;>BA
@H10C:D1D8LACXX:2:1101:1269:2133_F/1
GACAGAAGGAGGTTCAATGTACCAGGAAGCCTANG
+ERR1719154.2.1 H10C:D1D8LACXX:2:1101:1269:2133 length=35
=ABDDDFFBCDF<E<FFEHHEFIF>GEFEGFIF#0
@H10C:D1D8LACXX:2:1101:1411:2137_F/1
TGCTAATTTACTAGGATTGCAATGACTAGTAAGAACGTGTCATCATCAGGACAGCAATCCCCGTCACGGCAAAAAGCAATGGAAATTGGTTCAAAAAGC
+ERR1719154.3.1 H10C:D1D8LACXX:2:1101:1411:2137 length=99
=DDDFFFHGHHIIGHGIIJIJJJIIJIIJGIGIIIIJFGHGGGIEHIIIJFIJGIIIIJJIIJJJIJEHFFDCCDDDDDDDDACDDDDDDDDDEDDDD8
@H10C:D1D8LACXX:2:1101:1332:2138_F/1
AAATATCTCGTTCAACCTAATTATTATCCTCGTTGTTTGACTGCTTTGGTTAGATTAGTTAGTAGCATACCATTGCAATAGCCGAATGGATAAAACCTT
+ERR1719154.4.1 H10C:D1D8LACXX:2:1101:1332:2138 length=99
BDFFFFHHHHHJJJJJJJJJJJJJJJJJJJJJIJJHIJIHIJJJIJJIJHGFIBCHIJHHGIGGIIGGIHDHHCHHGGHFFFFFDDDDDCCDDDDDBDD
ADD REPLYlink modified 13 months ago by h.mon27k • written 13 months ago by Guillermo D. Huerta10

I think the sequence header is fine, but the quality header may cause trouble. How did you download / manipulate the files? I don't know if this is the cause of the error, but the quality header line (+ERR1719154.1.1 H10C:D1D8LACXX:2:1101:1390:2131 length=92) is different from the sequence header line (@H10C:D1D8LACXX:2:1101:1390:2131_F/1).

ADD REPLYlink modified 13 months ago • written 13 months ago by h.mon27k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1500 users visited in the last hour