Question: How to fetch GFF information for genome downloaded from ENA?
0
gravatar for athulmenonk
19 months ago by
athulmenonk0 wrote:

Hi,

We have done variant analysis using Oryza sativa Indica genome downloaded from the link below. https://www.ebi.ac.uk/ena/data/view/GCA_000004655.2 - (WGS_SET_FASTA)

Later for doing the annotation, we were not able to find a corresponding GFF file for the genome fasta.

Sample Genome fasta format is as below.

>ENA|AAAA02000004|AAAA02000004.1 Oryza sativa Indica Group cultivar 93-11 chromosome 1 Ctg000004, whole genome shotgun sequence.
GGGCGTTACGTCTTCACGACCGGCTTGCCTTCGCCGCTGCCACGGTGTTTCCGCCTGCAC
GGCTGGCCTTTATGCCGCCGTTGTTGGGCGTCTACGTCTTCACCGACCGGCTTGCCTTCG
CCGCTGCCGACTGCTGTTTCCGCCTGCACGGCTGGCCTTTATGCCGCCGTTGTTGGGCGT

We tried to download GFF from various other databases all are having different chromosome notations. Is there any way we can fetch GFF for this. Or if there is anyway to convert these "AAAA02000004.1" ids to fetch gene informations?

Thank you in advance.

Regards, Athul

oryza snp snpeff annotation genome • 541 views
ADD COMMENTlink modified 19 months ago by WouterDeCoster43k • written 19 months ago by athulmenonk0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1820 users visited in the last hour