Question: error in mapper script in miRDeep2
0
gravatar for nivya.james2016
8 months ago by
nivya.james20160 wrote:

Hi all

I'm used the following mapper script for miRNA alignment in miRdeep2. I am getting error and also the reads_vs_genome.arf is empty. I am posting the error message herewith

    mapper.pl trim_3_SRR7189567.fastq -e -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p /home/shanthi/Desktop/Nivya/indexed_genome/genome.fa -s collapsed_reads.fa -t collapsed_reads_vs_genome.arf -v -n -h
    parsing fastq to fasta format
discarding sequences with non-canonical letters
clipping 3' adapters
discarding short reads
collapsing reads
mapping reads to genome index
usage: /home/shanthi/miniconda2/bin/convert_bowtie_output.pl reads_mapped.bwt
trimming unmapped nts in the 3' ends
Log file for this run is in mapper_logs and called mapper.log_28941
Mapping statistics


    #desc   total   mapped  unmapped    %mapped %unmapped
Use of uninitialized value $count2 in subtraction (-) at /home/shanthi/miniconda2/bin/mapper.pl line 708.
total: 2716769  Use of uninitialized value $count2 in print at /home/shanthi/miniconda2/bin/mapper.pl line 708.
    2716769 Use of uninitialized value $count2 in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 709.
Use of uninitialized value $count2 in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 709.
0.000   1.000
Use of uninitialized value in subtraction (-) at /home/shanthi/miniconda2/bin/mapper.pl line 711.
seq: 2716769    Use of uninitialized value in print at /home/shanthi/miniconda2/bin/mapper.pl line 711.
    2716769 Use of uninitialized value in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 712.
Use of uninitialized value in division (/) at /home/shanthi/miniconda2/bin/mapper.pl line 712.
0.000   1.000

Could somebody help me??

Thank You in advance

mirdeep2 mapper module • 284 views
ADD COMMENTlink modified 8 months ago by finswimmer11k • written 8 months ago by nivya.james20160
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 954 users visited in the last hour